Clone FMO01015 Report

Search the DGRC for FMO01015

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:15
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRab11-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01015.3prime Sequence

810 bp (-563 high quality bases) assembled on 2008-02-20

> FMO01015.3prime
AATTTTTAATATCCCCACCCCCCTCCCGCGCCCGGCGAGGGCGGGGGTGT
TTTTTTTTTAAGCCCACCGCCCCCGCCCCCTCCTACTAGCAGAGGGGGGG
GGTGTTTTTTTTTTTTTTCGCCCCCCCCGCGGGGGGGGGGGGGACCCCCC
CCCCCCCCCTATATAATTTCCCCCCCCCCACAAAAAAAAAATATTTTTTG
TGGTTTTTGGGGGCCCCCCCTCTTCTTTTTTTTTTTTTTCTAACTTTTTT
ATAAAAAAAAAAAAGGGGGGGGGGGGGGATTTTTTTTTTTTTTTTTTTTT
GGGGGGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCCCCCCCCCCC
AAAAAAAAAGAAAAAAATTTTTTTTTTTGGGGGAAGGGGGAAAAAAAAAA
AACCCCCCCCCCCCCCCCCCCTTTTTTTTTTTGGGGGGGGGGGGGGGGGG
AGATTTTTTTAAGGGGGGGGGGGGGGCGCCCCCCCCCCCCCCTTTTTAAT
AAAAAAAGAAAGAAAGGGCAAAAAAAATTTTTTTTGGGGGGGGGGTTTTT
CCCAAAATTGGGCCTTTAAATTTTTTTCCCCCCCCCCCCCTTTTTGGGGG
GGGGGGGGGAAAAATAAAACCCCAATTTTGGGGGTTGGGGTTTCAAAAAA
AAAATTTCCTTGGGGGGGGGAAAAGGGGGGGGGGAAAAATTTTTTTTTCC
CAACCCCCCGGGTTCCCGTAAGGACAATTTGACCGGAAAATGGAAGTGTT
TTTTTTTTGCCCCCATTTGATGAAACCTCCCGTTTTACGGTATGCTATAC
GAAGGTTTAG

FMO01015.3prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 22:24:06 has no hits.
Blast to na_all.dmel.RELEASE6 performed on 2014-11-28 22:24:04 has no hits.
Blast to na_te.dros performed on 2014-11-28 22:24:05 has no hits.

FMO01015.3prime Sim4 Records

Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 22:58:05 has no hits.
Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 22:58:05 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-05 01:01:30 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-05 01:01:30 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2010-07-30 09:24:27 has no hits.