Clone FMO01020 Report

Search the DGRC for FMO01020

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:20
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5823-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01020.5prime Sequence

1248 bp (645 high quality bases) assembled on 2008-03-07

> FMO01020.5prime
AAAGCAAAGTTATCAGTCGACATGTCCTCGTCGTCGACGTCCGGCGGCCG
GAAGCAACCCACTGCTGTGTCGCGCATGAAGCAGGACTATATGCGCCTCA
AGCGGGATCCCCTGCCGTACATAACCGCCGAGCCGCTGCCCAACAACATC
CTCGAGTGGCACTACTGCGTCAAGGGGCCGGAGGACTCGCCCTACTACGG
CGGCTACTACCACGGCACCCTGCTCTTTCCGCGCGAGTTCCCATTCAAGC
CGCCATCCATCTACATGCTGACGCCGAACGGTCGCTTCAAGACCAACACC
AGACTGTGTTTGAGTATATCAGATTTTCATCCGGACACTTGGAACCCGAC
TTGGTGCGTAGGCACCATTCTCACTGGACTGCTGAGCTTCATGCTGGAGA
GCACACCCACACTCGGATCCATCGAATCATCGAATTATGACAAGCAAATG
TTTGCTCAAAAATCACTAGCATTTAACCTGCGCAACACCAACTTCTGTGA
GCTGTTTCCGGAGATAGTCGAAGAGATCAAGCAGCGGCTGCGAGGAACAC
AGGCGGCAGCTGCTGTGGACGGACCCGCTGCCAATGGAGTAAAGCGTTCC
ACGGGACTGGCCAACGGAGCGAGCCTGGCATCTGCGGATGGCAATCTGGC
GGTGGGCGGCTTGCCCAATCCACTGAATGCAGCGGACGCAATCGATGGCG
GGCGGCGGGTCAGGCGGATTTTGGCCAGCGGCCGCAGGAGCGGCGGTCCA
AATATTGCACGGAACTCCTATCTAAACTGGCAGTCCGTCTATTCAAACCT
GGGATCATTATCTGCTTTGCAATTGTTTGCCCTCATTGTTATTACGTGAT
CAAGAACCCTGAATCAGGACTCAAGCTTTCCTAGAATCATTTCGTTTGGC
GCGCGGGCCTTGTTAATTGTCTTAACATAATCATAATCATAATTCATAAT
CTCTACTTAGCCTAGGAGATCTCTGGTCATGACTAGTGTTTGAATTCCCA
CCAAAAAAAATCGCTCGTCGGCAACCTGACGTTCTGAACAGTCCAGATTG
TAATTCCTAAGGTCATTATTGATCATCAACGGAGTCAAGCGAGCTCGAAA
TTAAATTACCCCCCGTCCTGGTCCTCTCCTCTCCCGTCCTGTTTAATTCT
TAAACATTCCGGCCAACTGAGCCTTCAAGCCATAGAACCTGTATTCGCGG
CGCACCAACCTGGTCACCTGTGCATATATAATTTGTCCATGTGGGGAG

FMO01020.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:15:49
Subject Length Description Subject Range Query Range Score Percent Strand
CG5823-RB 1789 CG5823-RB 542..1390 21..869 3975 98.4 Plus
CG5823-RA 1850 CG5823-RA 603..1451 21..869 3975 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:15:47
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 17532724..17533200 869..393 1915 97.1 Minus
3R 32079331 3R 17533623..17533924 322..21 1510 100 Minus
3R 32079331 3R 17533260..17533334 393..319 375 100 Minus
Blast to na_te.dros performed on 2014-11-28 22:15:48 has no hits.

FMO01020.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:45 Download gff for FMO01020.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5823-RA 585..1439 14..869 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:46:46 Download gff for FMO01020.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5823-RA 597..1451 14..869 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:03:32 Download gff for FMO01020.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5823-RA 597..1451 14..869 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:03:32 Download gff for FMO01020.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 17533623..17533927 14..322 98   Minus
3R 17533260..17533330 323..393 100 <- Minus
3R 17532724..17533199 394..869 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:46:46 Download gff for FMO01020.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 13359345..13359649 14..322 98   Minus
arm_3R 13358982..13359052 323..393 100 <- Minus
arm_3R 13358446..13358921 394..869 97 <- Minus