Clone FMO01023 Report

Search the DGRC for FMO01023

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:23
Vector:pMK33-CFH-BD
Associated Gene/TranscriptKlc-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01023.5prime Sequence

1281 bp (633 high quality bases) assembled on 2008-03-07

> FMO01023.5prime
AAGAACAAAGTTATCAGTCGACATGACGCAAATGTCGCAGGATGAAATCA
TAACCAATACGAAAACAGTCCTTCAAGGCCTCGAAGCCTTGCGAGTGGAG
CATGTTTCGATTATGAACGGAATCGCCGAGGTGCAGAAGGACAATGAAAA
GTCGGACATGCTGCGAAAGAACATCGAGAACATCGAACTGGGCCTCAGCG
AGGCCCAGGTGATGATGGCCCTGACATCCCATCTGCAGAACATCGAGGCC
GAGAAGCACAAGCTTAAGACACAGGTGCGCCGCCTCCACCAGGAGAACGC
CTGGCTTCGCGACGAGCTGGCCAACACTCAGCAAAAGTTCCAGGCATCCG
ATCAGCTGGTGGCCCAACTAGAGGAGGAGAAGAAGCACCTGGAGTTCATG
GCGTCCGTGAAGAAGTACGACGAGAATCAGGAGCAGGACGACGTTTGCGA
CAAGTCCCGCACCGATCCCGTGGTCGAGCTATTCCCGGACGAGGAAAACG
AGGACAGACACAACATGTCGCCCACTCCGCCCAGCCAGTTCGCCAACCAG
ACTTCCGGCTACGAGATTCCAGCGCGTCTCCGTACTCTGCACAACCTGGT
CATTCAGTATGCATCGCAGGGAAGATACTAGGTAGCCGTTCCCCTCTGCA
AGCAAGCATTGGAATATCTCGAAAGGACAAGTGGTCACGACCATCCCGAT
GTTCAACCATGCTTAACATTTTGGCTCTTCGTGTACCGCGATCAGAACAA
GTATAAGGAGGCCGCCCATTTTACTCAACGACGCTCTGTCGATTTCGAGG
AAAGACACTGGGCTAGAACCATCCAGCGTGGCGGCACGTTGATCACTGTG
TGCTGTCCTCTATGGCAACGTGGCAAGTATAAATATTCTCGATGCCTCTG
TGCAAGCGTGCCTTGGATAATCCGAAAAGAAATCCTTGGTTAATGTGCAT
CCCGATGTTGCCTATGAATTTAACAATTTCTCCTTGCTCCTGCCGGAATC
AGGGCAAATACTACGAGGGTTGAAATGTTCTACAACGGAGCTCTCGAATT
CTACGAATCAAGTTTGGGTTCCGGATGGTCCTAAGGTTGCCCAATCAAAA
TATTATTCTGGTCTGTCTGGCTTATCTGGAGCATGTTTAATACCCGGAAC
TGGAATTTCTCTTTTATAGTCAGGTCTTTTGCCGGGAGCCTGAACGTGGT
AGTTTGGAACTCTCGTCGCATACAATGGCTATTTTTGTGGCGGTGTGTCT
GAGAGAGATGGGAGGGGGGACGGATACCCTA

FMO01023.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:42:08
Subject Length Description Subject Range Query Range Score Percent Strand
Klc-RC 1876 CG5433-RC 156..1217 23..1091 4210 94 Plus
Klc-RB 1841 CG5433-RB 118..1179 23..1091 4210 94 Plus
Klc-RA 1843 CG5433-RA 120..1181 23..1091 4210 94 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:42:06
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 12748056..12748657 624..23 2965 99.5 Minus
3L 28110227 3L 12747821..12747943 745..623 460 95.2 Minus
3L 28110227 3L 12747433..12747757 1073..743 455 84.1 Minus
Blast to na_te.dros performed 2014-11-28 19:42:07
Subject Length Description Subject Range Query Range Score Percent Strand
G5A 2841 G5A G5A 2841bp 880..912 753..785 111 81.8 Plus

FMO01023.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:41 Download gff for FMO01023.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5433-RA 111..1171 13..1081 93   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:16 Download gff for FMO01023.5prime
Subject Subject Range Query Range Percent Splice Strand
Klc-RA 111..1171 13..1081 93   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:24:26 Download gff for FMO01023.5prime
Subject Subject Range Query Range Percent Splice Strand
Klc-RA 111..1171 13..1081 93   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:24:26 Download gff for FMO01023.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 12748056..12748666 13..624 98   Minus
3L 12747821..12747941 625..745 95 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:16 Download gff for FMO01023.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 12741156..12741766 13..624 98   Minus
arm_3L 12740921..12741041 625..745 95 <- Minus