Clone FMO01024 Report

Search the DGRC for FMO01024

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:24
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcm-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01024.5prime Sequence

1168 bp (894 high quality bases) assembled on 2008-02-20

> FMO01024.5prime
TTAAACAAAGTTATCAGTCGACATGATACACAGTCTGTTTATTGTAAACA
GCGGCGGCGAGGTCTTCCTGGAAAAGCATTGGCGCTCGGTTGTCTCGAGA
TCTGTGTGCGAATACTTCCTTGACGCCCAGCGCGCTGCTCCATATGATGT
GCCGCCGGTGATAGCCACGCCCCACTACTACCTGATTACAGTGCAAAGGG
ACACGGTGTCTTTGGTCGCCGCCTGCAAGCAGGAGGTGCCGCCGCTCTTT
GTCATCGAGTTCCTGCATCGCGTGGTGGACACCTTCCAGGACTATTTCGG
CGACTGCTCCGAGTCCGTGATCAAGGACAACTATGTGGTCGTTTACGAGC
TGCTGGACGAGATGCTCGATAATGGCTTCCCACTGGCCACCGAGAGCAAC
ATCCTCAAGGAGCTGATCAAGCCGCCCAATATCCTGTTGCATCATTGCCA
ACACGGTGACGGGCAAGAGCAATGTAAGCACTACTTTGCCCTCGGGTCAG
CTGTCGGCGGTTCGCTGGCGCAGAAGCGGCGTGAGGTACACCAACAACGA
GGCGTACTTCGATGTCATCGAGGAGGTGGACGCTATCATTGATAAATCCG
GATCCACGGTCTTTGCCGAGATCCACCGACATATCGACTGCTGCATTAAG
TTATCCGGCATGCCAGATCTGACGTTATCTTTCATGAATCCTCGCCTCTT
CGACGACGTTTCCTTCCATCCTTGCGTGCGCTACAAGCGCTGGGAGGCGG
GAGCGCCTGCTCTCCTTTATCCCGCCCGACGGAAACTTCCGCCTGATGTC
ATATCACATTAGCTCTCAGTTCCGTGGTGGCCATACCCATCTACATCACG
CACAACTTTTCGATCAAACGGGGTGAGCAGTGGCGTCTGGACCTCACGAT
TGGCCCGAGGACACCCTTGATCGCACCTATTGACAAGTGAAGCTTGGAGC
TGACATTGTCGCGGTGTGTGCTTAATTGCCTTATTGACCGCGAATCAGGG
AAAGTATACCTTCGATTCGGTGACCAGACGCTGTCCTGGGATGGTGGATC
GGATCGATGTTTCCATAGTTGCCATATATAGGGATTCGATTCAGTTACGT
CAGATACGACCAACATCGATGCCTATTCACTCCGTGAATGGTCAGATTCC
AATCTCTGCAACTCTATC

FMO01024.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:26:54
Subject Length Description Subject Range Query Range Score Percent Strand
cm-RB 1774 CG3035-RB 55..1179 23..1152 4835 95.9 Plus
cm-RA 1469 CG3035-RA 55..1179 23..1152 4835 95.9 Plus
Inx7-RB 1690 CG2977-RB 1..159 993..1152 415 86.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:26:52
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 7010519..7010844 472..146 1555 99.1 Minus
X 23542271 X 7009784..7010226 1079..633 1545 93.8 Minus
X 23542271 X 7010290..7010442 625..473 765 100 Minus
X 23542271 X 7010899..7010988 146..57 450 100 Minus
Blast to na_te.dros performed on 2014-11-28 21:26:53 has no hits.

FMO01024.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:03 Download gff for FMO01024.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3035-RA 37..1160 17..1143 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:32:58 Download gff for FMO01024.5prime
Subject Subject Range Query Range Percent Splice Strand
cm-RA 47..1170 17..1143 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:23:03 Download gff for FMO01024.5prime
Subject Subject Range Query Range Percent Splice Strand
cm-RA 47..1170 17..1143 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:23:03 Download gff for FMO01024.5prime
Subject Subject Range Query Range Percent Splice Strand
X 7011057..7011099 17..57 93   Minus
X 7010900..7010987 58..145 100 <- Minus
X 7010519..7010844 146..472 99 <- Minus
X 7010283..7010442 473..632 98 <- Minus
X 7009774..7010226 633..1088 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:32:58 Download gff for FMO01024.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6905090..6905132 17..57 93   Minus
arm_X 6904933..6905020 58..145 100 <- Minus
arm_X 6904552..6904877 146..472 99 <- Minus
arm_X 6904316..6904475 473..632 98 <- Minus
arm_X 6903807..6904259 633..1088 94 <- Minus