Clone FMO01025 Report

Search the DGRC for FMO01025

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:25
Vector:pMK33-CFH-BD
Associated Gene/Transcripttan-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01025.5prime Sequence

898 bp (370 high quality bases) assembled on 2008-02-20

> FMO01025.5prime
TTTAAACAAAGTTATCAGTCGACATGGATAACATAGTCTACGACTTTGCC
AAGATCACGTTTCAAGCAAAAGACAACAGGTCACCCACTACTAACTCGAA
TCTGTCGTGGCAACTAAATCAGATGGCCTTGTCGGACATGGAGGAGATGC
AGGACACATCCGAGCCCATAGCTCCACCCGAATCCGATGACAATGTCAGC
AGTGAATCGCATGACTCCGACGATGTAGACTCGCAATTGAGTCGCTGCGA
GGACAACGATGACGACAGCGATTGCATCAGTGGATCCTCCAGACGCAGTT
CCACTTTTTGGAGCTCGAGCGGGCGTGGGCTCGTCGCAGAATGCCCCGCC
AGGGTGTCCAAGGACAACTTTTAACCGGATCTGCAGCGCCATCATGAAAC
CCATCAAAAAAAAAGCAACGGCAAAAAATGGACCCCAATGCCCTTTCACT
TTAAAACATTCAAAAAATTCTACACCACCGGGGCATGAAAAATTCCCCGC
CCCCCCATCTGGAAAAAATCTTCCAAGGAACCCGCGATGAAAAATGCCCC
CCAATGCCAAGAACAACAGCAAAAATGCTCCCATCCGCCGCCCAATGGAA
AGTAGTTAAGGGGGGGGGGTCCCAAATCTCCCCCGGCAAATTCCTTCAGC
GATGCGCCTGAAAAAAAAAAAATTCTGTGTAAAAAAAGCCCCCCAAAGGT
GAAAAAAAAACTTTGGGAACGTTTTCCACTCTCAAAAAATCTCTCTTGAA
CCAAGTTCCACGAACTGCTTAAAAAAACTTTCTCACGTGGGCATGGTCGG
GAGGGGAATAAATACAAAGACGGAGGAATCGCGGAGACCCTCACACATCC
CGAGAATCTCTGTAGCACAGGAGAAACATCACCTGTCGACAACGAGAC

FMO01025.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:27:04
Subject Length Description Subject Range Query Range Score Percent Strand
tan-RB 1657 CG6586-RB 316..1043 24..763 2140 88.1 Plus
tan-RA 1494 CG6586-RA 316..1043 24..763 2140 88.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:27:02
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 6055714..6056172 77..540 1525 92 Plus
3L 28110227 3L 6055608..6055665 24..81 290 100 Plus
Blast to na_te.dros performed on 2014-11-28 21:27:03 has no hits.

FMO01025.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:07 Download gff for FMO01025.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6586-RA 274..656 24..410 98 == Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:33:05 Download gff for FMO01025.5prime
Subject Subject Range Query Range Percent Splice Strand
tan-RA 316..698 24..410 98 == Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:23:09 Download gff for FMO01025.5prime
Subject Subject Range Query Range Percent Splice Strand
tan-RA 316..698 24..410 98 == Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:23:09 Download gff for FMO01025.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 6055717..6056043 80..410 98 == Plus
3L 6055608..6055663 24..79 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:33:05 Download gff for FMO01025.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 6048817..6049143 80..410 98 == Plus
arm_3L 6048708..6048763 24..79 100 -> Plus