Clone FMO01027 Report

Search the DGRC for FMO01027

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:27
Vector:pMK33-CFH-BD
Associated Gene/TranscriptUch-L3-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01027.5prime Sequence

1218 bp (960 high quality bases) assembled on 2008-02-20

> FMO01027.5prime
CAGTCGACATGGGCGACGGTGCTGGAAATTGGTGTCTCATTGAATCCGAT
CCCGGGGTATTCACAGAGCTTATTCGCGAATTCGGATGCGATGGGGCACA
GGTGGAGGAGATCTGGAGTCTCGACAGCGAGTCCTTCAAGAACCTAGAGC
CCATCCATGGTCTGATCTTCCTGTTCAAGTGGGTGCAGGAGGATGAACCC
GCTGGAAAAGTGGTCCTGGATCGGGAGAACATCTTCTTTGCCAAGCAGGT
GATCAACAACGCATGCGCCACCCAGGCGATCTTGAGCCTCCTGATGAACC
TGGATCATGAGGACATCAAATTGGGCGAGACCCTCACCAATTTTAAGGAG
TTCTGCCAGTGCTTCGATCCGTACAACAAGGGATTAACTTTGAGCAACGC
TAGCCAGATTCGCACGGTGCATAACTCTTTTGCTCGCCCAACACTCTTCG
AGCTGGACACTAAGAACCAGAAGAAGGACGATGACGTGTACCACTTTGTC
GGCTATATGCCCATCGGAGGAAGACTGTACGAGCTGGACGGCCTGAGGGA
GGGACCCATTGATCTTGGTGAGATCAAGTCGGAGCAGAACTGGATCGATG
TGGTGCGTCCGATTATTGAGAAGCGCATGCAGCGCTACAGCGACGGCGAG
ATCCACTTCACTCTGATGGCTCTGATCTCGGACAGGCAGCGCATTTATGA
ACAGCAGATTGAGAAGCTGCTTAATCCGGCGCCCAATGCTATGGACACTG
AGGAGGATCGACAGGCGGAGATCAGTAGCTTGCGCACGTACATAGAGTAC
GAGATTCAGAAAAAGAAGCGCTACAAAGTGAGAATGTGCGGCGCAAGCAC
AACTATTTGCTCTTCATCGTGAGCTCTTAAAATTCTGGGCGAGAACGGAC
ACTAATGCTCATCTACGAGAAGCCAAGCAGAGGCGCTAGACGCGAGCAGC
GCACGCAAAAAGATACCGACGCAGCTTTCTAGACCATTCGTTGGGGCGGC
GGGCCCAGTAGTGGTCTAATCATAAATCATAATCCTATCTTAATCCACTA
GGCTAAGGAGATCCTGTCCTGACATATTGCCTGATCTCACCAATAAAACG
CCCCGCGGCCACCGACGTTGGACAAATCGAATGGAATCTGAGCATATCGG
ATTACAAGGATCACGAACCGAATCAATAAGCCGCCCGCATCTACTGCAAA
CGGGTGTGAATACTATTA

FMO01027.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:00:49
Subject Length Description Subject Range Query Range Score Percent Strand
Uch-L5-RB 1153 CG3431-RB 117..1090 7..970 4545 98.5 Plus
Uch-L5-RA 1394 CG3431-RA 117..1090 7..970 4545 98.5 Plus
Uch-L5R-RA 1298 CG1950-RA 642..835 489..682 280 76.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:00:47
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 9475839..9476693 933..84 3950 98.8 Minus
3L 28110227 3L 9476771..9476849 85..7 395 100 Minus
X 23542271 X 12055801..12055994 682..489 280 76.3 Minus
Blast to na_te.dros performed on 2014-11-28 20:00:48 has no hits.

FMO01027.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:08 Download gff for FMO01027.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3431-RA 119..1108 1..981 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:22:19 Download gff for FMO01027.5prime
Subject Subject Range Query Range Percent Splice Strand
Uch-L5-RA 111..1100 1..981 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:48:42 Download gff for FMO01027.5prime
Subject Subject Range Query Range Percent Splice Strand
Uch-L5-RA 111..1100 1..981 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:48:42 Download gff for FMO01027.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 9476772..9476853 1..84 95   Minus
3L 9475787..9476692 85..981 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:22:19 Download gff for FMO01027.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 9469872..9469953 1..84 95   Minus
arm_3L 9468887..9469792 85..981 97 <- Minus