Clone FMO01029 Report

Search the DGRC for FMO01029

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:29
Vector:pMK33-CFH-BD
Associated Gene/TranscriptVps4-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01029.5prime Sequence

474 bp (181 high quality bases) assembled on 2008-02-20

> FMO01029.5prime
CAGTCGACATGGCAGCCGGTACCACACTACAGAAGGCCATCGATCTGGTG
ACCAAGGCCACCGAGGAGGATCGAAATAAGAACTACGCGGAGGCACTGCG
TCTGTATGAGCACGGGGTGGAGTACTTCCTGCACACCATCAAATATGAGG
CACAGGGCGAGAGGCCAATGACTCGATACGGGCCAGTGCCTGCAGATTGG
ACGGGTCAGAGTAAGAGACTGAGAAGAAAAAGAACGTCAAGAGTTTACAG
GGAAGAGGAAACAAAGGAAGGAAGAGAGGGCAATAAAAAAAAGGAAACGG
GGAGTTGTAAAAACCAGGCGGGCAATGCGGCCGCCCCAAGGGCGAAGGGC
TTTTGGATAACCCGTTCCCCGGAAATTCCGGAAACCCTGTTCCCCCGAAA
AAATAAGGAGGGGGCGCAGAAACACCCCCCCCTTTGGCAATAAAGAAAAG
GGGGGGGGAAAAAAATAAAAAAAA

FMO01029.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:31:12
Subject Length Description Subject Range Query Range Score Percent Strand
Vps4-RB 2411 CG6842-RB 164..353 8..195 885 98.4 Plus
Vps4-RA 2031 CG6842-RA 164..353 8..195 885 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:31:10
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 17908577..17908713 8..144 685 100 Plus
Blast to na_te.dros performed 2014-11-28 23:31:11
Subject Length Description Subject Range Query Range Score Percent Strand
TART-A 13424 TART-A 13424bp 7746..7790 253..297 108 71.1 Plus

FMO01029.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:48 Download gff for FMO01029.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6842-RA 162..370 1..205 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:26:57 Download gff for FMO01029.5prime
Subject Subject Range Query Range Percent Splice Strand
Vps4-RA 157..365 1..205 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:15:01 Download gff for FMO01029.5prime
Subject Subject Range Query Range Percent Splice Strand
Vps4-RA 157..365 1..205 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:15:01 Download gff for FMO01029.5prime
Subject Subject Range Query Range Percent Splice Strand
X 17908808..17908849 145..185 95 == Plus
X 17908571..17908713 1..144 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:26:57 Download gff for FMO01029.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 17802841..17802882 145..185 95 == Plus
arm_X 17802604..17802746 1..144 97 -> Plus