Clone FMO01032 Report

Search the DGRC for FMO01032

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:32
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPros25-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01032.5prime Sequence

729 bp (729 high quality bases) assembled on 2008-02-20

> FMO01032.5prime
CAGTCGACATGGCTACCGAACGATACAGCTTTTCGTTGACCACGTTCAGT
CCTTCCGGAAAACTCGTCCAACTGGAGTATGCATTGGCGGCCGTATCTGG
CGGAGCTCCCTCCGTGGGCATTATAGCTTCCAACGGCGTCGTCATTGCCA
CAGAGAACAAACACAAGTCACCGCTGTATGAGCAGCACAGTGTACATCGC
GTGGAGATGATCTACAACCACATCGGCATGGTGTACTCGGGAATGGGTCC
GGACTACCGCCTGCTGGTCAAGCAGGCCCGCAAGATCGCCCAGACGTACT
ACCTGACCTACAAGGAGCCGATTCCAGTGTCACAGCTGGTGCAGCGCGTG
GCCACGCTCATGCAGGAGTACACTCAGTCCGGTGGCGTTCGTCCCTTTGG
CGTTTCCCTACTGATCTGCGGCTGGGACAATGATCGTCCGTATCTCTACC
AATCCGATCCTTCGGGCGCCTACTTCGCCTGGAAGGCCACTGCCATGGGC
AAGAACGCAGTGAACGGCAAAACTTTCCTGGAGAAGCGCTACAGCGAAGA
TCTGGAGCTGGACGACGCTGTTTCACACCGCCATCCTTACGCTGAAAGAA
GGTTTTGAGGGAAAAATGACTGCCGACAACATTGAGATCGGAATCTGCGA
CCAGAACGGATTCCAGCGTCTGGACCCCGCCTCAATCAAGGACTACTTGG
CCAGCATCCCCGCAAGCTTTCTAGACCAT

FMO01032.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:44:19
Subject Length Description Subject Range Query Range Score Percent Strand
Prosalpha2-RA 920 CG5266-RA 121..822 9..711 3475 99.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:44:18
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 12431743..12432001 124..382 1295 100 Plus
3R 32079331 3R 12432286..12432458 538..711 805 98.9 Plus
3R 32079331 3R 12432066..12432222 382..538 785 100 Plus
3R 32079331 3R 12431581..12431660 47..126 400 100 Plus
3R 32079331 3R 12431441..12431481 9..49 205 100 Plus
Blast to na_te.dros performed on 2014-11-28 18:44:18 has no hits.

FMO01032.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:10 Download gff for FMO01032.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5266-RA 109..825 1..719 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:19:09 Download gff for FMO01032.5prime
Subject Subject Range Query Range Percent Splice Strand
Prosalpha2-RA 113..829 1..719 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:34:57 Download gff for FMO01032.5prime
Subject Subject Range Query Range Percent Splice Strand
Prosalpha2-RA 113..829 1..719 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:34:57 Download gff for FMO01032.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 12432287..12432465 539..719 97   Plus
3R 12432067..12432222 383..538 100 -> Plus
3R 12431746..12432001 127..382 100 -> Plus
3R 12431584..12431660 50..126 100 -> Plus
3R 12431433..12431481 1..49 91 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:19:09 Download gff for FMO01032.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 8258009..8258187 539..719 97   Plus
arm_3R 8257789..8257944 383..538 100 -> Plus
arm_3R 8257468..8257723 127..382 100 -> Plus
arm_3R 8257306..8257382 50..126 100 -> Plus
arm_3R 8257155..8257203 1..49 91 -> Plus