Clone FMO01035 Report

Search the DGRC for FMO01035

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:35
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCHOp24-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01035.5prime Sequence

651 bp (651 high quality bases) assembled on 2008-02-20

> FMO01035.5prime
CAGTCGACATGGAATCGACACTCGCCAAGGTGCTGCTCCTTGTGGGCAGC
CTGCTGATCCTGTGCCGCACCAGCCACGCCTTCATCGTCAGCGTGGACGC
CCACAATGAGGAGTGCTTCTTCGAGAACGTCGAAGGCGGCACCAAGTTTG
GCGTCACCTTCGAGGTGATCGACGGTGGCTTCCTAGACGTGGACATCAAG
ATCAGCGGCCCGGATAACCATGTGATGCACGAGAGCGAAAAGGAGTCGTC
CGGCAAGTACACCTTTGTGGCCCCCGCCAAGGGAACCTACACCGTGTGCT
TCAACAACGAACGCAGCAGCATGACCCCCAAGCTGGTCATGTTCTCCATC
GACGTGGGTGACGCACCGCAACGTGCGCCCGGAGCACCCGGCGAGGAGGA
GGTGGGCCACACCAAGCTGGAGGACATGATTCGGGAGCTCTCCGGCACGC
TGACCAGTGTCAAGCACGAACAGGAGTACATGCATGTGCGCGACAAGATC
CATCGTTCGGTGAACGAGAACACCAACTCGCGAGTGGTGCTGTGGTCCAC
CTTCGAAGCCCTCGTCCTGGTCCTGATGACAGTGGGCCAGGTGTACTACC
TGAAACGCTTCTTCGAGGTCAACCCGCGTCGTGGCAAGCTTTCTAGACCA
T

FMO01035.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:23:38
Subject Length Description Subject Range Query Range Score Percent Strand
CHOp24-RB 1172 CG3564-RB 96..719 9..633 3085 99.7 Plus
CHOp24-RA 1104 CG3564-RA 96..719 9..633 3085 99.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:23:37
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 4541216..4541554 150..488 1695 100 Plus
X 23542271 X 4541003..4541145 9..151 715 100 Plus
X 23542271 X 4541907..4542043 486..622 685 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:23:37 has no hits.

FMO01035.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:04 Download gff for FMO01035.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3564-RA 88..720 1..637 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:33:06 Download gff for FMO01035.5prime
Subject Subject Range Query Range Percent Splice Strand
CHOp24-RA 90..722 1..637 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:01:26 Download gff for FMO01035.5prime
Subject Subject Range Query Range Percent Splice Strand
CHOp24-RA 90..722 1..637 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:01:26 Download gff for FMO01035.5prime
Subject Subject Range Query Range Percent Splice Strand
X 4541907..4542056 486..637 97   Plus
X 4541217..4541551 151..485 100 -> Plus
X 4540997..4541144 1..150 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:33:06 Download gff for FMO01035.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 4435940..4436089 486..637 97   Plus
arm_X 4435250..4435584 151..485 100 -> Plus
arm_X 4435030..4435177 1..150 97 -> Plus