Clone FMO01036 Report

Search the DGRC for FMO01036

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:36
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRab-RP4-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01036.5prime Sequence

631 bp (611 high quality bases) assembled on 2008-02-20

> FMO01036.5prime
AAAACAAAGTTATCAGTCGACATGGCTGATCGGGCTATCAAGCTGCTGGT
GATCGGGGAAAGCGGCGTGGGCAAGTCCAGTTTGATACGTCGCTTCGTGG
AGAACAAGTTCGACCAGAACCATGACGTCACGATTGGCATGGACTTCAAG
AGCAAAGTGATGCAGGTGGACGGCATAGACTACAAGGTGGCCCTGTGGGA
TACGGCGGGCGCCGAGAGATTCCGCAGCCTGACGCCCAGTTTCTATCGGA
AGGCTCTGGGCGCCATTCTAGTGTACGACATCACCAGCAGGGACAGCCTG
GTCAAGCTGGAAACCTGGCTGGCTGAACTGGATAGCTACAGCGACAATCC
CAACATTGCCATCATTGTGGTAGGCAACAAGATCGACGAGGAGCGAGTTG
TGGATCGCGAGGAGGGTCGAAAGTTTGCCAGGAAGCATAGGGCGCTCTTC
ATCGAGACCTCAGCCAAATGCGATCAGTTCGTCAGCGATGTGTTCAAAGA
TGTGGTGGAGAAGATCGTCTCCTCCGAATACTTCAACAATGGCAATGCCT
CTGCCGGTCTGGACATCGCCAGCGATCGGGATCTGGAGGCAAGCGCGTCT
ACGTGTTACTGTTTTATTTTTTCTAGACCAT

FMO01036.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:15:10
Subject Length Description Subject Range Query Range Score Percent Strand
Rab18-RA 833 CG3129-RA 152..743 22..613 2930 99.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:15:08
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 5671081..5671515 513..79 2160 99.8 Minus
X 23542271 X 5670917..5671018 613..512 495 99 Minus
X 23542271 X 5671603..5671661 80..22 295 100 Minus
Blast to na_te.dros performed on 2014-11-28 22:15:09 has no hits.

FMO01036.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:06 Download gff for FMO01036.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3129-RA 143..745 14..619 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:41:27 Download gff for FMO01036.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab18-RA 146..748 14..619 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:03:16 Download gff for FMO01036.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab18-RA 146..748 14..619 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:03:16 Download gff for FMO01036.5prime
Subject Subject Range Query Range Percent Splice Strand
X 5671603..5671665 14..80 94   Minus
X 5671081..5671513 81..513 99 <- Minus
X 5670920..5671016 514..610 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:41:27 Download gff for FMO01036.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 5565636..5565698 14..80 94   Minus
arm_X 5565114..5565546 81..513 99 <- Minus
arm_X 5564953..5565049 514..610 98 <- Minus