Clone FMO01038 Report

Search the DGRC for FMO01038

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:38
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAnnX-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01038.5prime Sequence

1009 bp (1009 high quality bases) assembled on 2008-02-20

> FMO01038.5prime
CAGTCGACATGGAATACAAACCCGTGCCCACGGTTAAGGACGCAGCTCCC
TTCGACGCCTCCCAGGACGCCCAGGTGCTGCGGGCGGCGATGAAGGGATT
CGGCACCGACGAGCAGGAAATCATCGACGTGCTCGTCGGCAGGAGCAACC
AGCAGAGGCAGACGATCAAGGCGGTTTACGAAGCGGAGTTCGAGCGCGAC
CTGGTGGACGATCTTAAGGACGAGCTGGGAGGCAAGTTCGAGGACGTGAT
CGTGGGTCTAATGATGCCACCAGTGGAGTACCTGTGCAAGCAACTGCACG
CCGCCATGGCGGGCATCGGAACCGAGGAGGCCACGCTCGTCGAGATCCTG
TGCACCAAGACCAACGAGGAGATGGCCCAGATCGTGGCCGTCTACGAGGA
GCGCTACCAGCGCCCGCTGGCCGAGCAGATGTGCAGCGAGACCTCCGGCT
TTTTCCGCCGCCTGCTCACGCTGATCGTGACCGGAGTACGTGACGGACTG
GACACGCCCGTCGACGTCGGTCAGGCCAAGGAGCAGGCCGCCCAGCTCTA
CTCGGCCGGCGAGGCCAAGCTGGGAACGGACGAGGAGGTCTTCAACCGGA
TCATGTCGCACGCCAGCTTCCCGCAGCTGCGACTCGTCTTCGAGGAGTAC
AAGGTGCTCTCCGGGCAGACCATCGAGCAGGCCATCAAGCACGAGATGTC
CGACGAGCTGCACGAGGCCATGATGGCCATAGTTGAGTGCGTCCAGTCAC
CGGCGGCCTTCTTCGCCAACCGCCTGTACAAGGCCATGAATGGCGCCGGC
ACCGATGACGCCACGCTCATCCGCATCATCGTCAGCCGCTCGGAGATCGA
CCTGAGACCATTAAGCAGAGTTCGAGCGGATCTACAACCGTACGCTGCAC
AGCGCCGTGGTGGCGGAGAACCTCTGGTGACTACAGCGGGACCTGACAGC
CCTACTTGGATTCCGCCGCAAGCTTTCTAGAACATTCGTTTGGCGCCGCG
GGCCCAGGT

FMO01038.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:14:30
Subject Length Description Subject Range Query Range Score Percent Strand
AnxB10-RA 1244 CG9579-RA 135..1094 9..967 4670 99.4 Plus
AnxB10-RB 1247 CG9579-RB 135..1097 9..967 4630 99.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:14:28
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 20172305..20173016 732..21 3560 100 Minus
X 23542271 X 20187343..20187594 732..481 1230 99.2 Minus
X 23542271 X 20179468..20179717 732..483 1220 99.2 Minus
X 23542271 X 20195077..20195326 732..483 1220 99.2 Minus
X 23542271 X 20202793..20203042 732..483 1220 99.2 Minus
X 23542271 X 20210463..20210712 732..483 1220 99.2 Minus
X 23542271 X 20218115..20218364 732..483 1220 99.2 Minus
X 23542271 X 20225850..20226099 732..483 1220 99.2 Minus
X 23542271 X 20172040..20172225 913..730 830 98.9 Minus
X 23542271 X 20179203..20179388 913..730 830 98.9 Minus
X 23542271 X 20194808..20194993 913..730 830 98.9 Minus
X 23542271 X 20202524..20202709 913..730 830 98.9 Minus
X 23542271 X 20210194..20210379 913..730 830 98.9 Minus
X 23542271 X 20187078..20187263 913..730 815 98.4 Minus
X 23542271 X 20217850..20218035 913..730 815 98.4 Minus
X 23542271 X 20225585..20225770 913..730 815 98.4 Minus
Blast to na_te.dros performed on 2014-11-28 20:14:29 has no hits.

FMO01038.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:13 Download gff for FMO01038.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9579-RA 136..1104 1..973 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:31:58 Download gff for FMO01038.5prime
Subject Subject Range Query Range Percent Splice Strand
AnxB10-RA 131..1099 1..973 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:53:49 Download gff for FMO01038.5prime
Subject Subject Range Query Range Percent Splice Strand
AnxB10-RA 131..1099 1..973 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:53:49 Download gff for FMO01038.5prime
Subject Subject Range Query Range Percent Splice Strand
X 20172305..20173016 21..732 100 <- Minus
X 20172041..20172222 733..912 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:31:58 Download gff for FMO01038.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 20066338..20067049 21..732 100 <- Minus
arm_X 20066074..20066255 733..912 98 <- Minus