Clone FMO01039 Report

Search the DGRC for FMO01039

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:39
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8386-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01039.5prime Sequence

518 bp (469 high quality bases) assembled on 2008-02-20

> FMO01039.5prime
CAATCCACATGGTGGACGACAGCACTCGAAAAACGTTGAGCAACATTCCG
CTGCTGCAGATTCGCGCTGGTCCGCGCGAAAAGGATGTGTGGGTGCAGCG
GCTCACGGAGGAGTACCAGGCACTAATTAATTATGTGGAGAACAACAAAC
AGTCCGGCAGCGACTGGTTCCGTCTGGAATCCAACAAGGAGGGCACCAAG
TGGTTCGGAAAGTGTTGGTACATGCACAACCTGTTAAAGTACGAGTTCGA
CGTGGAGTTCGACATTCCAGTGACATACCCAACCACCGCGCCCGAGATTG
CCCTGCCAGAACTTGACGGCAAGACAGCGAAGATGTACCGTGGTGGCAAG
ATCTGTCTGACGGATCACTTTAAGCCACTGTGGGCACGCAATGTTCCCAA
GTTTGGGATCGCCCACGCTATGGCTCTGGGTCTTGCTCCCTGGCTGGCCG
TGGAGATTCCGGATCTCATCTAGAAGGGAATCATTACGTACAAGGAAAAG
GCAAGCTTTCTAGACCAT

FMO01039.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:00:55
Subject Length Description Subject Range Query Range Score Percent Strand
CG8386-RA 656 CG8386-RA 101..592 9..500 2400 99.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:00:54
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16007087..16007386 431..132 1485 99.7 Minus
2R 25286936 2R 16007446..16007567 130..9 595 99.2 Minus
2R 25286936 2R 16006957..16007025 500..432 330 98.6 Minus
Blast to na_te.dros performed on 2014-11-28 20:00:54 has no hits.

FMO01039.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:15 Download gff for FMO01039.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8386-RA 89..589 9..511 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:22:21 Download gff for FMO01039.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8386-RA 101..601 9..511 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:48:46 Download gff for FMO01039.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8386-RA 101..601 9..511 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:48:46 Download gff for FMO01039.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 16007445..16007567 9..131 98   Minus
2R 16007087..16007386 132..431 99 <- Minus
2R 16006948..16007025 432..511 92 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:22:21 Download gff for FMO01039.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 11894950..11895072 9..131 98   Minus
arm_2R 11894592..11894891 132..431 99 <- Minus
arm_2R 11894453..11894530 432..511 92 <- Minus