Clone FMO01040 Report

Search the DGRC for FMO01040

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:40
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG7375-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01040.5prime Sequence

569 bp (569 high quality bases) assembled on 2008-02-20

> FMO01040.5prime
CAGTCGACATGATTAAACTATTCACGCTTAAGCAGCAGAAGAAAGACGGC
GAGCAAAAGGGCAGTCAGCAGAAGAAAGCGTCCGCCGCCCAGCTGCGCAT
ACAGAAAGATATTAACGAACTGAACCTGCCAAACACTTGCGCCACAGACT
TTCCCGATCCCAATGACTTGCTCAACTTCAAGCTTATCATCTCGCCCGAC
GAGGGCTTCTACAGAGACGGGCGCTTCGTGTTCAATTTCCGCGTCGGATC
CAACTATCCGCACGAGCCGCCCAAGGTGAAGTGCGCCACCCAGGTGTACC
ATCCCAATATTGACCTGGATGGCAACGTCTGCCTCAACATTCTGCGCGAG
GACTGGAATCCAGTGCTGAACATCAACTCCATCGTCTATGGCTTGCAGTT
TCTATTCTTGGAACCCAATCCCGAGGATCCGCTCAACAAGGAGGCGGCCG
ACGTCCTGCAGACCAACCGCCGTCAGTTCGAGAACAATGTAAAGAAGGCG
ATGCGTGGTGGCTGTGTGGGCGAGACCTACTTCGAGTGCTGTCTGCTCAA
GGCAAGCTTTCTAGACCAT

FMO01040.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:27:14
Subject Length Description Subject Range Query Range Score Percent Strand
UbcE2M-RC 1729 CG7375-RC 291..833 9..551 2715 100 Plus
UbcE2M-RB 916 CG7375-RB 164..706 9..551 2715 100 Plus
UbcE2M-RA 913 CG7375-RA 161..703 9..551 2715 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:27:12
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 8197141..8197445 411..107 1525 100 Minus
3L 28110227 3L 8196743..8196884 551..410 710 100 Minus
3L 28110227 3L 8197522..8197621 108..9 500 100 Minus
Blast to na_te.dros performed on 2014-11-28 21:27:13 has no hits.

FMO01040.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:16 Download gff for FMO01040.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7375-RA 153..702 1..551 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:33:12 Download gff for FMO01040.5prime
Subject Subject Range Query Range Percent Splice Strand
Ubc12-RA 154..703 1..551 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:23:16 Download gff for FMO01040.5prime
Subject Subject Range Query Range Percent Splice Strand
UbcE2M-RA 154..703 1..551 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:23:16 Download gff for FMO01040.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 8197522..8197628 1..108 96   Minus
3L 8197142..8197443 109..410 100 <- Minus
3L 8196743..8196883 411..551 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:33:12 Download gff for FMO01040.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 8190622..8190728 1..108 96   Minus
arm_3L 8190242..8190543 109..410 100 <- Minus
arm_3L 8189843..8189983 411..551 100 <- Minus