Clone FMO01041 Report

Search the DGRC for FMO01041

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:41
Vector:pMK33-CFH-BD
Associated Gene/TranscriptProsalpha5-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01041.5prime Sequence

773 bp (773 high quality bases) assembled on 2008-03-07

> FMO01041.5prime
ATAAAAAAAAGTTATCAGTCGACATGTTTCTCACGCGTTCCGAGTACGAC
AGAGGCGTGAACACCTTCTCGCCGGAGGGCCGCCTCTTCCAAGTGGAATA
TGCCATTGAGGCCATCAAATTGGGCTCCACAGCAATTGGAATTTGCACGC
CAGAAGGAGTGGTTTTGGCGGTGGAGAAGCGCATCACTTCGCCGCTAATG
GTACCCAGTACTGTGGAGAAGATTGTGGAGGTGGACAAGCACATTGGTTG
CGCCACCTCCGGCTTGATGGCCGATGCCAGGACTCTGATCGAGAGGGCAC
GCGTGGAGTGCCAGAACCACTGGTTCGTCTACAACGAGCGCATGTCCATC
GAGTCCTGCGCCCAGGCTGTGTCCACTTTGGCCATCCAGTTCGGTGATAG
TGGCGACAGCGATGGTGCCGCCGCCATGAGTCGTCCCTTTGGTGTGGCCA
TTCTATTTGCCGGCATCGAGGCGGGACAACCCCAGTTGTGGCACATGGAT
CCCTCCGGCACATTCGTGCGCCACGGAGCCAAGGCCATTGGCTCGGGCAG
CGAAGGTGCTCAGCAGAATCTGCAGGACTTATTTAGACCCGATTTGACTC
TCGATGAGGCTATCGACATTTCGCTCAACACACTTAAACAGGTTATGGAG
GAGAAACTAAACTCCACCAATGTGGAGGTGATGACCATGACGAAAGAAAG
AGAGTTCTACATGTTCACCAAGGAGGAGGTGGAGCAGCACATTAAGAACA
TTGCGGCAAGCTTTCTAGACCAT

FMO01041.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:42:27
Subject Length Description Subject Range Query Range Score Percent Strand
Prosalpha5-RB 873 CG10938-RB 72..804 23..755 3665 100 Plus
Prosalpha5-RA 884 CG10938-RA 83..815 23..755 3665 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:42:25
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 17413100..17413700 155..755 3005 100 Plus
2R 25286936 2R 17412910..17413044 23..157 675 100 Plus
Blast to na_te.dros performed on 2014-11-28 19:42:26 has no hits.

FMO01041.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:51 Download gff for FMO01041.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10938-RB 58..809 8..761 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:27 Download gff for FMO01041.5prime
Subject Subject Range Query Range Percent Splice Strand
Prosalpha5-RA 80..820 16..761 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:24:34 Download gff for FMO01041.5prime
Subject Subject Range Query Range Percent Splice Strand
Prosalpha5-RA 80..820 16..761 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:24:34 Download gff for FMO01041.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 17413102..17413705 157..761 99   Plus
2R 17412903..17413043 17..156 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:27 Download gff for FMO01041.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 13300607..13301210 157..761 99   Plus
arm_2R 13300408..13300548 17..156 97 -> Plus