Clone FMO01044 Report

Search the DGRC for FMO01044

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:44
Vector:pMK33-CFH-BD
Associated Gene/TranscriptHspB8-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01044.5prime Sequence

590 bp (590 high quality bases) assembled on 2008-03-07

> FMO01044.5prime
ATAAAACAAAGTTATCAGTCGACATGGCCGAGGCTAACAAGAGGAATATC
CCCATCAAGCTGGGCGACTTCAGCGTCATCGACACGGAGTTCAGCAACAT
CCGCGAGCGCTTCGACTCCGAGATGCGCAAAATGGAGGAGGAGATGGCCA
AGTTCCGTCACGAGCTGATGAACCGCGAGGCGAACTTCTTCGAGTCCACC
AGCTCAACGACAAACTCGGCGCTGCCATCCCGAATCCCAAAGCAACAGAA
CTACGTCTCCGACATTAGCTCACCCTTGATCCAGGATGAGGGCGATAACA
AAGTGCTGAAGCTGCGTTTCGATGTCAGCCAGTATGCGCCCGAGGAAATT
GTTGTGAAAACCGTCGACCAGAAGCTATTGGTGCACGCCAAGCACGAGGA
GAAGTCGGACACAAAGAGCGTGTACAGGGAGTACAATCGGGAGTTCCTGC
TGCCCAAGGGCGTCAATCCCGAGTCCATCCGCTCGTCCCTCAGCAAGGAC
GGAGTCCTGACCGTGGACGCCCCCCTGCCAGCACTCACCGCCGGCGAGAC
ACTGATTCCCATTGCGCACAAGGCAAGCTTTCTAGACCAT

FMO01044.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:15:01
Subject Length Description Subject Range Query Range Score Percent Strand
CG14207-RD 1380 CG14207-RD 306..854 24..572 2745 100 Plus
CG14207-RA 1240 CG14207-RA 306..854 24..572 2745 100 Plus
CG14207-RC 753 CG14207-RC 110..487 195..572 1890 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:14:59
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 19610695..19610887 380..572 965 100 Plus
X 23542271 X 19605504..19605682 24..202 895 100 Plus
X 23542271 X 19610525..19610625 282..382 505 100 Plus
X 23542271 X 19610378..19610463 200..285 430 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:15:00 has no hits.

FMO01044.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:53 Download gff for FMO01044.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14207-RA 337..900 16..577 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:32:19 Download gff for FMO01044.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14207-RA 296..859 16..577 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:54:07 Download gff for FMO01044.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14207-RA 296..859 16..577 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:54:07 Download gff for FMO01044.5prime
Subject Subject Range Query Range Percent Splice Strand
X 19610696..19610892 381..577 98   Plus
X 19610528..19610623 285..380 100 -> Plus
X 19610381..19610462 203..284 100 -> Plus
X 19605497..19605682 16..202 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:32:19 Download gff for FMO01044.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 19504729..19504925 381..577 98   Plus
arm_X 19504561..19504656 285..380 100 -> Plus
arm_X 19504414..19504495 203..284 100 -> Plus
arm_X 19499530..19499715 16..202 97 -> Plus