Clone FMO01046 Report

Search the DGRC for FMO01046

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:46
Vector:pMK33-CFH-BD
Associated Gene/Transcriptpex2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01046.5prime Sequence

883 bp (840 high quality bases) assembled on 2008-03-07

> FMO01046.5prime
ATGGCCAAGTTATCAGTCGACATGGAGAAAAACAAATATGTACCACGTGT
AAATCAATAGATGCCATCTATTTGAACAAGGACATTGCCCGCCTGTTCCC
CGATAATCTGCTGGAGAACTTGCAAGCCATCTCACCCGTTTTGTTCATCA
AAATCCAACCGGAGCTCGACTTGATCATTCAATCCGCAATTTGGTTTGGT
TCCGTCGGCAAGCGGTGCTCCACTTTTGGCCAACAGCTACTGGTTCTGGC
TTACGATGCCGAAAAGCTGACCGTTTCCAGGCTGGTGCTCCATTTCATCC
TGACCGTCTTGCCGGGCTACGTGAAGAGCTGGGAGGAGCGACTCTTAACA
AGGCGCGTAGAATGGTTTAGCGAGGCGATTATGTGGGTGGAGAACAGTGC
CCTGATACTGAACATCCTCAATTACTTTCGGTTTTTGAAGACAGGACGAA
AACCCACTTTGGTGGACTACTTATTGGGATTGGACTACATTAGTCTGCGG
AACAATCAAAGGAGAGACATTGGCTACAAGTACCTAACGAGGGAGCTGCT
GTGGGGAGGATTTATGGAAATCCTCGGACTGGTGTTGCCCATCATCAATT
TCCGTAAGCTACAAAGAGTGCTAAAATCATGGACATTTTCCGGACGACGG
TTAGAGGATAGAGATGGTCCGGCTTTCCTGGCGCCGCAGATGACACTAAG
CACCACCTTGCACATTCTGTGGAGAGCGACCTCACATTGCCCCACCACAT
GGGCTGTGGTCATATTTATTGCTATTTACTGCCTTAATGCAAATGTTTTA
ACGGATGCCAGTTTCTGCTGCCCCAACTGCGGTTCTGCGTGTCCTGAGTC
GGGAATCCAAAGTGTCGCAAGCTTTCTAGACAT

FMO01046.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:25:21
Subject Length Description Subject Range Query Range Score Percent Strand
Pex2-RA 1051 CG7081-RA 105..947 22..866 4040 98.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:25:18
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 8339390..8339822 135..567 2120 99.3 Plus
3L 28110227 3L 8339875..8340172 566..866 1355 99 Plus
3L 28110227 3L 8339257..8339334 57..134 345 96.2 Plus
Blast to na_te.dros performed on 2014-11-28 22:25:20 has no hits.

FMO01046.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:50 Download gff for FMO01046.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7081-RA 103..945 22..866 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:02:14 Download gff for FMO01046.5prime
Subject Subject Range Query Range Percent Splice Strand
Pex2-RA 105..947 22..866 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:58:40 Download gff for FMO01046.5prime
Subject Subject Range Query Range Percent Splice Strand
Pex2-RA 105..947 22..866 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:58:40 Download gff for FMO01046.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 8339876..8340172 567..866 99   Plus
3L 8339390..8339821 135..566 99 -> Plus
3L 8339257..8339334 57..134 96 -> Plus
3L 8339155..8339190 22..56 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:02:14 Download gff for FMO01046.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 8332976..8333272 567..866 99   Plus
arm_3L 8332490..8332921 135..566 99 -> Plus
arm_3L 8332357..8332434 57..134 96 -> Plus
arm_3L 8332255..8332290 22..56 97 -> Plus