Clone FMO01048 Report

Search the DGRC for FMO01048

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:48
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG30382-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01048.5prime Sequence

772 bp (735 high quality bases) assembled on 2008-02-20

> FMO01048.5prime
ATTAAACGAAGTTATCAGTCGACATGTCTCGCGGAAGTTCACCCGGCTTT
GACAGACACATCACGATCTTCTCTCCGGAGGGACGCCTCTACCAAGTGGA
GTACGCCTTCAAGGCTATTGCCCAAGAGAACATCACCACGGTGGCGCTGA
AGAGTGGCGACTGTGCCGTGGTGGCCACCCAAAAAAAAGTGACCGACAAG
AACATCGTGCCTGAAACGGTGACCCACCTGTTCCGCATCACCAAGGACAT
TGGATGCGCAATGACCGGACGCATAGCTGATTCCCGCTCACAGGTGCAGA
AGGCCAAATACGAGGCCGCCAACTTCCGCTACAAGTACGGCTACCAAATG
CCCGTGGATGTGCTGTGTCGTCGAATTGCGGATATCAACCAGGTGTACAC
GCAGAATGCCGAGATGCGTCCGCTCGGCTGCAGCATGGTGCTGATCGCTT
ACGACAATGAAATCGGCCCCAGCGTTTACAAGACGGACCCGGCTGGCTAC
TTCAGCGGGTTCAAGGCCTGCAGCGTGGGTGCCAAGACTCTGGAGGCCAA
CAGCTATCTGGAAAGAAGTACAAGCCCAACTTGTCGGAGGAGAAAGCGAT
CCAGCTGGCCCTCTCCTGTCTGTCCAGTGTGCTCCCTATAGACTTCAAGC
CGAACGGCATTGAGATCGGCGTGGTCAGCAAGTCTGATCCCACTTTCCGT
ATTTTGGATGAGCGGGAGATCGAGGAACACCTCACCACGATCGCCGAGAA
GGACGCAAGCTTTCTAGACCAT

FMO01048.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:23:48
Subject Length Description Subject Range Query Range Score Percent Strand
Prosalpha1-RB 969 CG18495-RB 136..868 23..754 3520 98.8 Plus
Prosalpha1-RA 902 CG18495-RA 69..801 23..754 3520 98.8 Plus
CG30382-RB 885 CG30382-RB 52..784 23..754 3520 98.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:23:47
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 7827404..7827885 754..274 2285 98.8 Minus
2R 25286936 2R 7830514..7830995 754..274 2285 98.8 Minus
2R 25286936 2R 7828171..7828348 276..99 860 98.9 Minus
2R 25286936 2R 7831281..7831458 276..99 860 98.9 Minus
2R 25286936 2R 7828410..7828486 99..23 370 98.7 Minus
2R 25286936 2R 7831520..7831596 99..23 370 98.7 Minus
Blast to na_te.dros performed on 2014-11-28 20:23:47 has no hits.

FMO01048.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:12 Download gff for FMO01048.5prime
Subject Subject Range Query Range Percent Splice Strand
CG18495-RA 47..792 17..765 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:33:10 Download gff for FMO01048.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30382-RB 47..792 17..765 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:01:34 Download gff for FMO01048.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30382-RB 47..792 17..765 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:01:34 Download gff for FMO01048.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 7828410..7828491 17..99 95   Minus
2R 7828171..7828347 100..276 98 <- Minus
2R 7827396..7827882 277..765 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:33:10 Download gff for FMO01048.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 3715915..3715996 17..99 95   Minus
arm_2R 3715676..3715852 100..276 98 <- Minus
arm_2R 3714901..3715387 277..765 97 <- Minus