Clone FMO01049 Report

Search the DGRC for FMO01049

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:49
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRab2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01049.5prime Sequence

686 bp (443 high quality bases) assembled on 2008-02-20

> FMO01049.5prime
CTTAAAATAAAAATATCAGTCGACATGTCCTACGCGTACTTGTCCAAATA
GATCATTATCGGAGACACAGGGGTGGGCAAGTCCTGTCTGCTGCTCCAGT
TCACGGACAAGCGATTCCTGCCGGTGCACGACCTGACCATTGGCGTGGAG
TTCGGAGCACGCATGATCACCATCGACGGCAAGCAGATCAAGCTTCAGAT
CTGGGACACGGCTGGGCAGGAGGCTTTCAGATCTATCACACGCTCTTATT
ACCGCGGAGCTGCTGGCGCCTTGCTGGTGTACGACATCACGCGACGGGAG
ACCTTCCACCACCTGACCACCTGGCTGGAGGATGCGCGTCAGCACTCGAA
CTCGAACATGGTCATTATGCTGATAGGCAACAATAGCGATTTGGATTCCC
GGTGTGAGGTGAAGAAAGAGGAGGGCGAGGCCTTCGCCCGCGAGCACGGA
CTGGTCTTCATGGAGACTTCTGCGCGCACAGCTGCCAACGTAGAGGAGGC
GTTCATAAATACGGCCAAAGAGATTTACGAGAAAGATCCAGGAAGGTGTC
TTCGACATCAACAATGAGGCAAACGGCATTACTATCGGCCCACAGCACTC
CCCCACAAAACCCGTCGCTCCCTGGAGTCGGAGCATCTTCTTGTATTTTT
TTTATTTTTGTCCGCTGCGCATGCTTTCTAGAGCAT

FMO01049.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:15:18
Subject Length Description Subject Range Query Range Score Percent Strand
Rab2-RB 1087 CG3269-RB 144..752 23..633 2795 97.4 Plus
Rab2-RA 1712 CG3269-RA 144..752 23..633 2795 97.4 Plus
Rab14-RD 878 CG4212-RD 105..343 46..284 310 76 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:15:15
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 6698047..6698386 229..569 1595 98.5 Plus
2R 25286936 2R 6697413..6697575 68..230 770 98.2 Plus
2L 23513712 2L 14357540..14357688 136..284 265 78.5 Plus
2R 25286936 2R 6696882..6696940 23..81 220 91.5 Plus
2R 25286936 2R 6698444..6698509 567..633 210 91 Plus
Blast to na_te.dros performed on 2014-11-28 22:15:17 has no hits.

FMO01049.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed on 2010-07-30 09:24:09 has no hits.
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:41:29 Download gff for FMO01049.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab2-RA 144..752 23..633 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:03:20 Download gff for FMO01049.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab2-RA 144..752 23..633 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:03:20 Download gff for FMO01049.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 6698049..6698385 231..568 98 -> Plus
2R 6697416..6697575 71..230 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:41:29 Download gff for FMO01049.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 2585554..2585890 231..568 98 -> Plus
arm_2R 2584921..2585080 71..230 98 -> Plus