Clone FMO01051 Report

Search the DGRC for FMO01051

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:51
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG6971-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01051.5prime Sequence

776 bp (776 high quality bases) assembled on 2008-02-20

> FMO01051.5prime
CAGTCGACATGGAGGAGCTGGATATAACAAGCGTGGGTCAATTCCAGACC
CTGGTGCGCTACAACAACCCGGTGCTGGTGGTGAAGCACCCGGACAAGAA
AGGGGGTGCTCCGCTCACAGAGATAGAGATGAAAAGGCCCCAAACGGCGG
GCGCTTTGCTAGATACCAAAAGGGAAACTGAGGAAATTCTAAATTCTATA
TTGCCACCGCGCTGCTGGGAGGAGGATGGCCAGTTGTGGCAGCAGTCTGT
GTCCAGTACTCCAGCAACACGCCAGGATGTGATCAATTTGCAGGAGATGC
TTGATACTAGGCTGCAGCAGACCCAAGCTCGTGAGACAGGTATTTGTCCC
GTGCGCCGCGAGCTGTACTCACAATGTTTTGACGAGATCATTCGCCAGGT
CACCATTAACTGTTCAGAGCGTGGCCTGCTACTGCTTCGCATCCGCGATG
AGATCGCCATGTCAATGGAGGCCTATGAAACATTGTACTGCAGTTCCGTA
GCCTTTGGCATGCGCAAGGCTTTGCAGGCGCATGAGGAAAAGGAAATGCT
TCGTGATCGGGTCAAGACTCTTGAACTAGACAAAGAGGCACTAGAGGAGA
TAATCGCAGATATGAAACTTAAGCAGGAACAGGCAGAGCGTCGTAATGCT
GAGCTGAGGGCCTCTGAAGAAAAGAAGTTCACGGAGGAGATAACTTTCCT
GAAGAAGACCAACGCTCAGCTGAAGGCTCAGCTAGAGGGCATAACCGCAC
CCAAGAAGGCAAGCTTTCTAGACCAT

FMO01051.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:41:07
Subject Length Description Subject Range Query Range Score Percent Strand
CG6971-RA 939 CG6971-RA 97..846 9..758 3750 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:41:05
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 11892399..11892776 758..381 1890 100 Minus
3R 32079331 3R 11892829..11893201 381..9 1865 100 Minus
Blast to na_te.dros performed on 2014-11-28 19:41:05 has no hits.

FMO01051.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:18 Download gff for FMO01051.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6971-RA 90..849 1..762 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:37:36 Download gff for FMO01051.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6971-RA 90..849 1..762 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:23:53 Download gff for FMO01051.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6971-RA 90..849 1..762 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:23:53 Download gff for FMO01051.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 11892829..11893208 1..381 98   Minus
3R 11892395..11892775 382..762 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:37:36 Download gff for FMO01051.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7718551..7718930 1..381 98   Minus
arm_3R 7718117..7718497 382..762 99 <- Minus