Clone FMO01052 Report

Search the DGRC for FMO01052

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:52
Vector:pMK33-CFH-BD
Associated Gene/TranscriptProsalpha7-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01052.5prime Sequence

785 bp (785 high quality bases) assembled on 2008-02-20

> FMO01052.5prime
CAGTCGACATGAGTACTATTGGCACTGGATACGACTTGTCGGCCTCGCAG
TTTTCGCCTGATGGCCGCGTTTTCCAGATCGACTACGCCTCAAAGGCGGT
GGAGAAGAGCGGCACCGTAATCGGGATTCGGGGCAAGGACGCCGTGGTGC
TGGCCGTGGAGAAGATCATCACCAGTAAACTGTACGAACCAGACGCCGGC
GGACGCATCTTCACCATCGAAAAGAACATCGGAATGGCGGTGGCCGGCTT
GGTGGCCGATGGAAACTTTGTGGCTGACATTGCGCGTCAGGAGGCAGCCA
ACTACAGACAGCAATTTGAGCAGGCTATCCCGCTTAAACACCTGTGCCAC
CGAGTCGCCGGCTACGTTCACGCCTACACTCTGTACAGTGCCGTCCGCCC
CTTCGGACTTTCCATCATTCTCGCCTCCTGGGACGAAGTAGAGGGGCCAC
AGCTCTACAAGATCGAGCCGTCCGGCTCCTCCTTCGGTTACTTCGCCTGC
GCCAGCGGCAAGGCCAAGCAGCTGGCCAAGACTGAGATGGAGAAGCTCAA
GATGGATATGAGGACCGACGAATTGGTGGAGAGCGCTGGTGAAATCATCT
ACAAAGTCCATGACGAGTTGAAGGACAAGGACTTCCGCTTCGAAATGGGT
TTGGTGGGCAGGGTAACCGGTGGCCTACATCTCATAAATCCCTCAGAACT
GACGGAGAAGGCGAGGAAAGCCGGCGATGCGGCCAACAAGGACGAAGACA
GCGACAATGAGACGCACGCAAGCTTTCTAGACCAT

FMO01052.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:23:59
Subject Length Description Subject Range Query Range Score Percent Strand
Prosalpha7-RA 976 CG1519-RA 120..878 9..767 3795 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:23:57
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 9847073..9847638 595..30 2830 100 Minus
2R 25286936 2R 9846734..9846905 767..596 860 100 Minus
Blast to na_te.dros performed 2014-11-28 20:23:58
Subject Length Description Subject Range Query Range Score Percent Strand
Rt1c 5443 Rt1c RT1C 5443bp 1817..1864 518..567 136 80 Plus

FMO01052.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:20 Download gff for FMO01052.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1519-RA 111..881 1..775 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:33:13 Download gff for FMO01052.5prime
Subject Subject Range Query Range Percent Splice Strand
Prosalpha7-RA 113..883 1..775 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:01:42 Download gff for FMO01052.5prime
Subject Subject Range Query Range Percent Splice Strand
Prosalpha7-RA 113..883 1..775 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:01:42 Download gff for FMO01052.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 9847073..9847638 30..595 100 <- Minus
2R 9846729..9846905 596..775 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:33:13 Download gff for FMO01052.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 5734578..5735143 30..595 100 <- Minus
arm_2R 5734234..5734410 596..775 97 <- Minus