Clone FMO01055 Report

Search the DGRC for FMO01055

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:55
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSnap-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01055.5prime Sequence

897 bp (897 high quality bases) assembled on 2008-02-20

> FMO01055.5prime
CAGTCGACATGGGTGACAACGAACAGAAGGCGCTCCAGCTGATGGCCGAG
GCGGAGAAGAAGTTGACCCAGCAGAAGGGCTTTCTGGGATCGCTGTTCGG
AGGGTCCAACAAGGTGGAGGACGCCATCGAGTGCTACCAGCGGGCGGGCA
ACATGTTTAAGATGTCCAAAAACTGGACAAAGGCTGGGGAGTGCTTCTGC
GAGGCGGCAACTCTACACGCGCGGGCTGGAAGTCGTCACGATGCCGGAAC
CTGCTACGTAGACGCTTCCAACTGCTACAAGAAGGTGGACGTGGAGAGCG
CCGTCAACTGCCTGATGAAGTCCATCGACATCTACACGGATATGGGCCGC
TTTACGATGGCTGCCAAACATCACCAAAGCATCGCCGAGATGTACGAAAG
TGATCCCAATAATCTGGCCAAGTCTATTCAGCACTATGAGCAGGCGGCTG
ATTACTTCAAGGGTGAAGAGTCGGTCAGTTCGGCCAACAAGTGCATGTTG
AAGGTGGCCCAGTACGCCGCCCAACTGGAGGATTACGAGAAAGCAATATC
CATATACGAGCAGGTGGCCGCCTCCTCGCTGGAGAGCTCTCTGCTCAAGT
ACAGTGCCAAGGAGTACTTCTTCAGGGCCGCTCTATGCCATCTCAGCGCG
GACCTCCTGAACGCCCAGCATGCCATCGAAAAGTATGCGCAGCAGTACCC
AGCATTCCAGGACTCCAGGGAGTTCAAGCTCATCAAGGTGTTGTGCGAGA
ATCTAGAGGAACAGAACATCGAGGGATTCACAGAGGCCGTCAAGGACTAC
GACAGCATCTCCCGGGTTGGATCAGTGTACACCACCATCTTGCTGCGGAT
CAGATGCTGCGACGAGATCCCGATCTGCGAGCAGCTTTCTAGACCAT

FMO01055.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:01:01
Subject Length Description Subject Range Query Range Score Percent Strand
alphaSnap-RA 2070 CG6625-RA 157..1037 4..880 4230 99.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:00:59
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 20314982..20315306 416..740 1610 99.7 Plus
3L 28110227 3L 20314607..20314924 100..417 1590 100 Plus
3L 28110227 3L 20315396..20315512 736..852 490 98.3 Plus
3L 28110227 3L 20313788..20313884 4..100 485 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:01:00 has no hits.

FMO01055.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:21 Download gff for FMO01055.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6625-RA 153..1035 1..880 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:22:23 Download gff for FMO01055.5prime
Subject Subject Range Query Range Percent Splice Strand
Snap-RA 155..1037 1..880 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:48:49 Download gff for FMO01055.5prime
Subject Subject Range Query Range Percent Splice Strand
alphaSnap-RA 155..1037 1..880 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:48:49 Download gff for FMO01055.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 20315398..20315544 738..880 95   Plus
3L 20314983..20315303 417..737 99 -> Plus
3L 20314608..20314923 101..416 100 -> Plus
3L 20313786..20313884 1..100 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:22:23 Download gff for FMO01055.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 20308498..20308644 738..880 95   Plus
arm_3L 20308083..20308403 417..737 99 -> Plus
arm_3L 20307708..20308023 101..416 100 -> Plus
arm_3L 20306886..20306984 1..100 98 -> Plus