Clone FMO01056 Report

Search the DGRC for FMO01056

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:56
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRab35-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01056.5prime Sequence

884 bp (884 high quality bases) assembled on 2008-02-20

> FMO01056.5prime
CAGTCGACATGGAGCAGACACCGATCACCGATGCGGAGAAGGTGCGCATC
GTATCGGACTTCATCCTACATGCGCCGCCCGGCGAGTTCAACGAAGTGTT
CAACGATGTGCGGGAGCTCCTCAAGAATGACACTCTGCTAAAGGATGGGG
CTAGCCACGCCTTCGCCCAATACAACAAGGACCAGCTGACTCCGGTTCGC
ATCGAGGGCACCGATCATAACGCCATCATATCGGAACACAACGATCTGGG
AAACGGTCGCTTCTACGACCCGCGCACAAAGCAAGCCTTCAAATACGACC
ACCTCCGAAAAGAGGCTTCCGACTACCAGGACGTAGAGGCAGATGCCACT
GCGGAGCCCTGGAGGGCGGCCCTCGACCTGGAGACGCTCGCCTACACTGC
CAGTCATTATAGACACGGGGTCAGCTCTGTTTTTGGAAAGGCGCAGGGCA
ACCAGATCACCCTGACCATTTGCATCGAAGACCACCAGTTCCAGCCGAAG
AACTATTGGAATGGCCGATGGCGCTCCCAGTGGCATGTGACCTTCCAGGC
GGGCAGCGGAACCGCCGAACTGAAGGGTGTGCTCAAGGTGCAGGTGCATT
ACTACGAGGACGGCAACGTCCAGCTGGTGTCCTCAAAGGAGTGCCGCGAA
AGCGTGGTGGTCAGCAACGAGCAGCAGGTGGCCAAGGAGGTGATCCGTCT
GATCGAGGACGCCGAGAATGAGTACCAGCTGGCCATTTCGGAGAACTATC
AGACGATGTCGGACACGACATTCAAGGCAATGCGTCGCCAGTTGCCCATC
ACCAGGACCAAGATCGACTGGAGCAAAATCGTCTCGTACAGCATTGGCAA
GGAACTGAAGACGCAAGCAAGCTTTCTAGACCAT

FMO01056.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:15:57
Subject Length Description Subject Range Query Range Score Percent Strand
cpa-RA 1918 CG10540-RA 236..1093 9..866 4290 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:15:55
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21058611..21059058 419..866 2240 100 Plus
2R 25286936 2R 21058022..21058263 9..250 1210 100 Plus
2R 25286936 2R 21058383..21058555 249..421 865 100 Plus
Blast to na_te.dros performed on 2014-11-28 22:15:56 has no hits.

FMO01056.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:00 Download gff for FMO01056.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10540-RA 222..1093 1..871 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:46:47 Download gff for FMO01056.5prime
Subject Subject Range Query Range Percent Splice Strand
cpa-RA 226..1097 1..871 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:03:35 Download gff for FMO01056.5prime
Subject Subject Range Query Range Percent Splice Strand
cpa-RA 226..1097 1..871 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:03:35 Download gff for FMO01056.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21058612..21059062 420..871 99   Plus
2R 21058384..21058553 250..419 100 -> Plus
2R 21058012..21058262 1..249 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:46:47 Download gff for FMO01056.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16946117..16946567 420..871 99   Plus
arm_2R 16945889..16946058 250..419 100 -> Plus
arm_2R 16945517..16945767 1..249 98 -> Plus