Clone FMO01057 Report

Search the DGRC for FMO01057

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:57
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPk17E-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01057.5prime Sequence

1253 bp (883 high quality bases) assembled on 2008-03-07

> FMO01057.5prime
AAAAACGAAGTTATCAGTCGACATGGGCAACTCGCAACCGCGTAATGCAA
GCAGAAGCAGAAGGACATCCCAGTGGCCACAAGGCGCAGCGGAACTAGGC
GCCTCAGCCAGCGATCACCACTACCACCAGGAGGAGCTGTATCAGGAGCA
GCAGCAGCAGCAACAACAGCCGCAACAGGAGCAACCGAGCAGCAGGAGAA
TCCAGTTCCAGGCCCACACCAACCAGCCAACACAGTCGCATCCTCCGGGC
GACGAGGAACAGCCTGTACAATCACAGCAGCAACAGCTTTCCACCTGGAG
TCTTGGCAGCCTTAGCGGAGGACGACTCAACTGGAGCTTCTCCGGTGCCC
GCAACTCATTTCGTCATCGAAACAAGGCCACGCGAAAGAGCTTGACCTCA
CTTCATGGCTCTCGTCGTGGCAAGACTCAGTGGCACCTTTCCTCTGACCA
ACTCAATCTTCAACTCGCACTTTAAGGAGACCAGCAAGAACGATCTGTAC
CGTATCGATCATTTGGTGGCCAAGGGAGCCTTTGGCGTGGTCTTCAAGGT
GTCCAGCAAGAGTGACATTAGTCAGTGCTACGTCCTGAAAGTGCTAAAGA
AATCAAAGCTCATCGAAGACAACAGTGTACGGCAGATAAAGGACGAGGCG
GACATTCAGAAGGTTTGCGGCCATCATCCGTTTATCGTGAAGCAAATAGA
TCTGTGGCAAAACCGCCACAACCTCCATATTCTATCGGAGTACGTACCCA
ACGGCGAGTTGTTCTCAAAAATAACTCACTTCTCCATTGATCTGGTTCGT
TTATATATTGGCGAGATAGCACTTGCCTTGATTTTCTCCACAACGCTGGG
ATTATATATCGTGATGCGAAGCCTGAGAACATCCTTGCTAACTGAACAGT
TTCACATAAAGCTAACCGACTTCGGCTTACAAGTGGCTCAAACTGGGGGC
TAACACTGCGCACATGTGTTGCACTTTCAATACATGGCCCGGAATATTCT
GTGCGGGGAACCTATGGCCATGCGGTGGAATTGGTGGGCCTTGGGGTTTT
TGCTTGTTCGAATGCTGACGCATATCGCCAACATCAACGCCACCTTACTG
CAACGCGTGAGAGCTGTGAACCGGGAGGAAGGCCTGTTCAATGCCTATCC
ATTGCTGATTAACGGCTCCTGAGCAATGACGGCAACGCGAGGACTTCCTG
GCTGGAGAGAAGTGGCAACACTCTACCACAGGAGGCAAAGGGAATAGTGG
CTC

FMO01057.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:16:17
Subject Length Description Subject Range Query Range Score Percent Strand
Pk17E-RA 2129 CG7001-RA 369..1559 23..1200 4955 95.6 Plus
Pk17E-RC 2123 CG7001-RC 369..1553 23..1200 4855 95.1 Plus
Pk17E-RB 1651 CG7001-RB 145..1081 277..1200 3685 94.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:16:14
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 18788832..18789089 23..280 1290 100 Plus
X 23542271 X 18790675..18790893 389..608 1005 98.2 Plus
X 23542271 X 18790956..18791081 607..732 630 100 Plus
X 23542271 X 18790503..18790615 278..390 565 100 Plus
X 23542271 X 18791300..18791451 830..980 485 90.8 Plus
X 23542271 X 18791146..18791243 733..830 475 99 Plus
Blast to na_te.dros performed 2014-11-28 22:16:15
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6887 153..310 202 63.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6769..6996 76..285 198 60.6 Plus

FMO01057.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:01 Download gff for FMO01057.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7001-RA 367..1404 23..1057 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:41:44 Download gff for FMO01057.5prime
Subject Subject Range Query Range Percent Splice Strand
Pk17E-RA 369..1406 23..1057 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:03:41 Download gff for FMO01057.5prime
Subject Subject Range Query Range Percent Splice Strand
Pk17E-RA 369..1406 23..1057 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:03:41 Download gff for FMO01057.5prime
Subject Subject Range Query Range Percent Splice Strand
X 18791301..18791459 831..987 94 -> Plus
X 18791146..18791244 733..830 97 -> Plus
X 18790958..18791081 609..732 100 -> Plus
X 18790677..18790893 391..608 98 -> Plus
X 18790506..18790615 281..390 100 -> Plus
X 18788832..18789089 23..280 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:41:44 Download gff for FMO01057.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 18685334..18685492 831..987 94 -> Plus
arm_X 18685179..18685277 733..830 97 -> Plus
arm_X 18684991..18685114 609..732 100 -> Plus
arm_X 18684710..18684926 391..608 98 -> Plus
arm_X 18684539..18684648 281..390 100 -> Plus
arm_X 18682865..18683122 23..280 100 -> Plus