Clone FMO01060 Report

Search the DGRC for FMO01060

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:60
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8979-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01060.5prime Sequence

1171 bp (947 high quality bases) assembled on 2008-02-20

> FMO01060.5prime
CAGTCGACATGACTGACCAACCAACTCCACAGTGGGTGACCAAGGAGCTA
TTCAGCAGCTTGTTGGAACAGAGTAATCGAAATTTCAAGGCGATCATTAA
ATTTGTTCCAACATCAGCGATTAGCAAAGGGGAAAACTATTTGACGATCG
TGCTGCGCATACAAATTGAAATGCAGCTGAAAGATAACAGCATAGAAGAT
GTCAGCTACATACTGAAGATTCCTTTAGTCCCGGAAGATGAGAAGAACGA
CTTCCACGAAATGTTCGATGCCGAACTGGACATGTACGATCATCTGATAC
CAGAATTGGAGGATCTATATGCCAAAAACACTTCCATATCACCAAAATTC
AAGCCTGTTCATCTGAAGTTTCCAGGAGAGCCGGTAAAAAGCGACTACAT
TCTTTTGGAGGATCTGCGGAAGAATTGATATAGGAATGCCGACAGAACCC
AGGGATTGGAGCAGTTTGAAGTGGAGGCGGTCCTCAAGAAGTTGGCACAG
TGGCACGCAGCCTCTGCAAAAAGAGTAGTCGAGCTGGGTGAATACGAGAA
GGACATCCGGGAGAGTTACTTTACTACTGAGCACCAGAAATTACTCGATG
AATTCAACATTAATTTTTGTATGCCCTTCCTGGAGTGCATGCAGCAATAT
AATCTTGAGCCAGGACAGCTCGTTCTCATAAGCGACTATACATCTCAACT
GACGGATCTGAATATTGAGTTTGGTAAGAACGATCCTCTGGAGTTATCTG
TGTTAAACCACGGAGATTTTTGGTGCAATAACTTTATGTTCAAGTATAAA
AACGCCTCAGAAGTGGAGGACGTTTGCTTTGTTGACTTCCAGCTCCCAAA
TATGGCACACCCGCCCAAGATCTTCTATGCATACTGATGACCTCACCTAA
GTCTTCAATCAAACTGTACAAATTCGACGATTTCATAGAGTATTATCACC
AGCAGCTAGTCGACACCTCACTATGCTCATACATCGGAATGCACCCACCC
TATCCAAGTTCCACGCCCATCTACTCGATATAATCTCTGGGCCTTTCATA
TGCGCGAGCTAATGCTTCCATGTTCAGGTCCCGCGATGTGAATCCATATC
AGCACGATATGTAATCCGAAGAGCGATCCATAACGTAAAGTTCGTGCGCT
ACGGATCGATTACGCCTAATG

FMO01060.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:21:16
Subject Length Description Subject Range Query Range Score Percent Strand
CHKov2-RA 1450 CG10675-RA 58..1141 9..1084 5015 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:21:14
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 25330423..25330921 680..182 2465 99.6 Minus
3R 32079331 3R 25330968..25331146 187..9 880 99.4 Minus
3R 32079331 3R 25330203..25330372 850..681 850 100 Minus
3R 32079331 3R 25329950..25330142 1041..854 660 94.3 Minus
Blast to na_te.dros performed on 2014-11-28 19:21:15 has no hits.

FMO01060.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:42:56 Download gff for FMO01060.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10675-RA 49..1131 1..1075 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:42 Download gff for FMO01060.5prime
Subject Subject Range Query Range Percent Splice Strand
CHKov2-RA 50..1132 1..1075 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:55:40 Download gff for FMO01060.5prime
Subject Subject Range Query Range Percent Splice Strand
CHKov2-RA 50..1132 1..1075 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:55:40 Download gff for FMO01060.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 25330972..25331153 1..183 97   Minus
3R 25330423..25330919 184..680 99 <- Minus
3R 25330198..25330372 681..854 99 <- Minus
3R 25329950..25330141 855..1041 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:42 Download gff for FMO01060.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 21156694..21156875 1..183 97   Minus
arm_3R 21156145..21156641 184..680 99 <- Minus
arm_3R 21155920..21156094 681..854 99 <- Minus
arm_3R 21155672..21155863 855..1041 94 <- Minus