Clone FMO01061 Report

Search the DGRC for FMO01061

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:61
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcalypso-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01061.5prime Sequence

1229 bp (963 high quality bases) assembled on 2008-02-20

> FMO01061.5prime
GAATTTTAATTTATCAGTCGACATGAACGCTGCTGGAGGTGGAAGGTGCC
CAGGCGGCCGCAGTGGCGGCAGGCAACAACAGTCTCAGCCACAATGCGCT
ACTTTCCACGGCCTTAGGAGCCACCACCATGCCTATGGCCCAACTGGCAG
ACGGTTGGTTGGAGCTGGAGTCCGACCCAGGTCTCTTCACACTGCTTCTC
AAGGATTTTGGATGTCACGATGTACAGGTGGAGGAGGTGTACGACCTACA
GAAACCCATCGAGAGTCCATATGGCTTCATATTTCTCTTCCGCTGGATCG
AAGAGCGACGCGCCAGACGCAAAATTGTGGAGACAACTGTTTTAGATATT
CGTCAAGGATGACGAGGCCATTTCCAGCATTTTCTTCGCCCCGCAGGTAG
TCCCCAATAGCTGTGCCACACACGCGTTGCTTTCGGTGCTCCTGAACTGC
AACGAGAACAATCTTCAGCTGGGCGACACCCTGAGTCGACTAAAAACCCA
CACCAAAGGCATGAGTCCGGAGAACAAGGGGCTGGCTATTGGCAACACTC
CGGAGCTGGCCTGTGCCCATAACTCACACGCAATGCCGCAGGCTCGGCGC
CGTCTAGAAAGGACGGGAGCGGGCGTCTCAAGTTGCCGCTTCACGGGCGA
GGCGTTTCACTTCGTTAGCTTTGTGCCTATCAATGGACAACTGTTTGAGC
TGGATGGCTTGAAACCGTATCCCATGAATCACGGCGGTTGGGAGGATAGC
GAGGATTGGACAGATAAGTTCCGACGTGTGATGGCTGAGCGACTGGGAAT
AGCGACCGGCGAACAGGACATACGTTTCAATCTCATGTCCGTAGTGCCAG
ACAGGCGGATTGCCATAACACATAAACTTAGATGCTGCGCACAAACCAGG
CAATCGTGTCCGGAACACTGCAGAAACTTCTAAAGGCCGACGAGCAGGCG
AATCGGGGAACGGAGAACTCCAACGTCCGGATACACCCACCACATTATTG
AGCCGAGCGCTTTCACCGCACGTGACCTGCAATCGCTTCTCTGAACCTGG
AGCAGGAATAGCATCAATGACCGCCACTTGGCTGGACAAAAACGATCGGA
AGCCTTGTTTAACGGTAAGCCGCGGTCCACGTATCCCAACATACAATAAG
ATTCTTTGCACCTCCATTAGCTGGACCCAAGGCTCTGGGCGACTGTCATC
ACACTTTCTTCTCTCAACTAAGGTCATAT

FMO01061.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:30:38
Subject Length Description Subject Range Query Range Score Percent Strand
calypso-RA 2147 CG8445-RA 359..1455 23..1112 4885 97 Plus
calypso-RB 2117 CG8445-RB 329..1425 23..1112 4885 97 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:30:36
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16194828..16195657 1041..214 3805 98.3 Minus
2R 25286936 2R 16195715..16195909 215..23 865 97.4 Minus
Blast to na_te.dros performed on 2014-11-28 23:30:37 has no hits.

FMO01061.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:22 Download gff for FMO01061.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8445-RB 298..1397 23..1116 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:26:35 Download gff for FMO01061.5prime
Subject Subject Range Query Range Percent Splice Strand
calypso-RB 329..1428 23..1116 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:14:41 Download gff for FMO01061.5prime
Subject Subject Range Query Range Percent Splice Strand
calypso-RB 329..1428 23..1116 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:14:41 Download gff for FMO01061.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 16195717..16195907 25..213 97 -- Minus
2R 16194828..16195657 214..1041 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:26:35 Download gff for FMO01061.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12083222..12083412 25..213 97 -- Minus
arm_2R 12082333..12083162 214..1041 98 <- Minus