Clone FMO01062 Report

Search the DGRC for FMO01062

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:62
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRab7-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01062.5prime Sequence

660 bp (660 high quality bases) assembled on 2008-02-20

> FMO01062.5prime
CAAACTATCAGTCGACATGTCCGGACGTAAGAAATCCCTACTGAAAGTCA
TCATTCTGGGCGACAGCAGTGTGGGCAAGACCTCTCTGATGAATCAGTAT
GTAAACAAACGCTTCTCCAACCAATACAAAGCCACGATCGGAGCTGATTT
CTGCACGAAAGAGGTGGTGGTCAACGACCGAGTGGTCACAATGCAGATCT
GGGACACTGCTGGTCAGGAACGCTTCCAGTCGCTTGGAGTGGCGTTTTAC
CGCGGAGCCGACTGCTGCGTGCTTGTCTACGATGTGACGGCGCCCAACTC
GTTCAAGAATCTCGACTCCTGGCGCGACGAGTTCCTCATACAGGCCAGTC
CACGGGATCCCGATCACTTCCCCTTCGTTGTGTTGGGCAATAAGGTGGAT
TTGGACAACCGCCAGGTGTCCACGCGTCGAGCGCAGCAATGGTGCCAATC
TAAGAACGATATACCCTACTACGAAACGTCCGCCAAGGAGGGCATCAACG
TGGAGATGGCGTTTCAAGTTATAGCCAAGAATGCGTTAGAGTTGGAGGCG
GAGGCTGAAGTTATCAACGATTTCCCCGATCAGATTACCTTGGGCTCGCA
AAACAATCGTCCTGGCAATCCTGACAACTGTCAGTGCGCAAGCTTTCTAG
ACCATTCGTC

FMO01062.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:48:03
Subject Length Description Subject Range Query Range Score Percent Strand
Rab7-RC 1280 CG5915-RC 150..775 12..637 3115 99.8 Plus
Rab7-RB 1269 CG5915-RB 139..764 12..637 3115 99.8 Plus
Rab7-RA 1515 CG5915-RA 185..810 12..637 3115 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:48:01
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23994243..23994603 194..554 1805 100 Plus
3R 32079331 3R 23993997..23994181 12..196 910 99.5 Plus
3R 32079331 3R 23994662..23994747 552..637 430 100 Plus
Blast to na_te.dros performed on 2014-11-28 19:48:03 has no hits.

FMO01062.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:24 Download gff for FMO01062.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5915-RA 174..811 1..641 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:41:46 Download gff for FMO01062.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab7-RA 176..813 1..641 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:27:30 Download gff for FMO01062.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab7-RA 176..813 1..641 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:27:30 Download gff for FMO01062.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 23994664..23994750 554..641 97   Plus
3R 23994246..23994602 197..553 100 -> Plus
3R 23993988..23994181 1..196 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:41:46 Download gff for FMO01062.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 19820386..19820472 554..641 97   Plus
arm_3R 19819968..19820324 197..553 100 -> Plus
arm_3R 19819710..19819903 1..196 97 -> Plus