Clone FMO01064 Report

Search the DGRC for FMO01064

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:64
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSyx17-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01064.5prime Sequence

928 bp (928 high quality bases) assembled on 2008-02-20

> FMO01064.5prime
CAGTCGACATGACGCGCGATGAGAAACTGCCACTTAAACAGGCGGAGGTC
TCCATCCAAAGGTTTCAGGATGTGGCGGTGCCCCACCATCTGAGCCTACT
GAAAAACCATCGCAGCAATATAGAAAAAAGCCTGGCGCTCGGCGACTGGC
AAAAAATCAAAAAGGAGGAACTCAATGCTATGAGGGTCATTAAGCAGATC
AAGAATCTACTTCTGGAAATGGATGCACTGCGAGAAAAAGTACGGGAGGA
GGATCTGGAACGTTTCGACGACCTAATGAAACCTGGCAGGGATACTGCCT
TCGCTGGCATGAAGGAATTTGCGGAGCTCCAACTCAAATCACCCACCTCC
ACTTTGAGTTCTCAGTACGACGACGATCTGGACAATCAGCCACAGGAGGT
GGATATGAACAGTCTACCCGCACACCGCCACATGCCCCAGCTGCAACTCA
ATTTCCAGCTGGAGGAACACCAATTGGCGCAGAGGCAAGCCTGCCTGGAT
CAGATGGAGAACCTGCAACAGGAGATCTACGATCTGCACGGGATGTTCCA
GGGAATGCGTCAACTGACTGCAGAGCAATCAGTGGCGGTGGAAAAGATAG
CAGACAATGCGGAGGAAGCTCTGGAGAATGTCCAGCAGGGCGAATTGAAT
CTGCGCCGGGCGCTCACCTACAAGAAGGCCATGTACCCCGTAGTCGGAGC
TCTTCTGGGCACCTGTGTGGGAGGACCCATTGGTCTGGTGGCGGGCATGA
AAGCTGGAGGATTGGCGGCAGTAGGATGTGGCATCCTCGGCTTCACCGGT
GGCTCTGTGCTAAAGGCCAATCCCAATGTAATGCATGGCAACATCGAGGA
GGAGCACGTGAACCGGATAGCGAGTCAACTGAGAGACTGGAGCTAAAAGA
GAAGCCAGAAGCAAGCTTTCTAGACCAT

FMO01064.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:15:26
Subject Length Description Subject Range Query Range Score Percent Strand
Syx17-RB 1566 CG7452-RB 341..1243 9..910 4475 99.8 Plus
Syx17-RA 1566 CG7452-RA 341..1243 9..910 4475 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:15:24
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 4404258..4404845 324..910 2875 99.7 Plus
3L 28110227 3L 4403950..4404197 77..324 1240 100 Plus
3L 28110227 3L 4403827..4403897 9..79 355 100 Plus
Blast to na_te.dros performed on 2014-11-28 22:15:25 has no hits.

FMO01064.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:25 Download gff for FMO01064.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7452-RA 319..1230 1..910 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:41:31 Download gff for FMO01064.5prime
Subject Subject Range Query Range Percent Splice Strand
Syx17-RA 332..1243 1..910 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:03:24 Download gff for FMO01064.5prime
Subject Subject Range Query Range Percent Splice Strand
Syx17-RA 332..1243 1..910 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:03:24 Download gff for FMO01064.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 4404259..4404845 325..910 99   Plus
3L 4403951..4404197 78..324 100 -> Plus
3L 4403818..4403895 1..77 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:41:31 Download gff for FMO01064.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 4404259..4404845 325..910 99   Plus
arm_3L 4403951..4404197 78..324 100 -> Plus
arm_3L 4403818..4403895 1..77 96 -> Plus