Clone FMO01067 Report

Search the DGRC for FMO01067

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:67
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG6330-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01067.5prime Sequence

1210 bp (997 high quality bases) assembled on 2008-02-20

> FMO01067.5prime
CAGTCGACATGCCGCCCACCATAACCGATAATCAGACGCACGACTTTAAG
GCCCACTACGATTGCGCCCACAGGTCCTCGCTGCAGGACGACGAGACGGA
CGATGCGTACGTGAAAAGGATAACGCGGTACTCCGATGGAACCGTCAAAT
TGCGCAACTCGAACATTGAGCTCATGGACCAGGATATCCTCTATCACCTG
GCCTTGGGCAGCGAGAGCCACGACCTGCAGGAGATGTTTGGCGACGTTAA
GTTCGTTTGCATGGGCGGCACACCAAAGCGCATGGAGAATTTTGCCCATT
TCATAATGAACGAGATTGGCTACAAGTTGCCAGCGGGCACCCAGCTGCAG
GACATCAGCGCCTATTCGTATCGCTACTCCATGTACAAAGTGGGACCGGT
GCTGTGCGTCAGCCATGGCATGGGTACGCCCTCGGTCAGCATCCTGATGC
ATGAGATGATCAAGCTGATGTACCACGCCAAGTGCAAGGATCCCGTCTTC
ATCAGGATAGGAACGTGCGGAGGAATTGGCGTCGACGGCGGCACCGTCAT
CATCACCGAAGATGCCCTCGATGGGCAGCTGAGGAACTCCCATGAGTTTA
CCATTCTCGGCAAGACCATCCATCGTCCTGCCAAGCTGGACAAAAAGCTG
GCCCGTGAGCTAAAGTCCCTGGCCAGTCCCGATGATCCGTACGATACCAT
TATTGGCAAGACGCTGTGCACCAACGATTTCTACGAGGGCCAGGGTCGTT
TGGACGGCGCATTCTGTGATTTCAGCGAGAACGAGAAGATGGCCTATCTG
GAGAAGCTGCGCGAGAACGGCGTGTCAACATCGAGATGGAGAGCACCATC
TTTGCGGCCCTGACCCACCATGCCGGCATCAAGGCAGCGGTGGTGTGTGT
CGCCCTGCTGAACCGCCTCAATGGGGATCAGTCAACGCGCCCAAGGAGGT
CATGAACGAGTGGCAGCGCGTCCGCAGATCCTCGTGTCGCGCTATATTCC
GCAGTCCTTACGCACAATGGACAGCTGGAGGGGCTATTTCGGAAACCAGG
ATCCTCCAGTCACCCCGGCGCTTCAGCTCGTCAGAAGGGTCTCAGCCACG
AGCAGCCTTCTAACATCGATGGGCGCGGCAGGTATGGACTAACTAACTAA
TTAAGATCACATAGCCTAGGATCTGGCTGACATGGCTTGAATTCACAATA
AAAAGCTCCC

FMO01067.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:24:26
Subject Length Description Subject Range Query Range Score Percent Strand
CG6330-RA 1541 CG6330-RA 132..1236 8..1102 5130 98.3 Plus
CG6330-RB 2075 CG6330-RB 355..1339 128..1102 4530 98.1 Plus
CG3788-RB 1758 CG3788-RB 928..1104 377..553 345 79.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:24:23
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 26951072..26951428 599..243 1755 99.4 Minus
3R 32079331 3R 26950642..26951009 965..600 1740 99.5 Minus
3R 32079331 3R 26951775..26951899 251..127 625 100 Minus
3R 32079331 3R 26953001..26953123 130..8 615 100 Minus
2R 25286936 2R 22932746..22932922 553..377 345 79.7 Minus
3R 32079331 3R 26950460..26950569 1075..968 255 86.4 Minus
Blast to na_te.dros performed 2014-11-28 19:24:25
Subject Length Description Subject Range Query Range Score Percent Strand
Tabor 7345 Tabor TABOR 7345bp 200..283 255..173 111 60.7 Minus
Tabor 7345 Tabor TABOR 7345bp 7039..7122 255..173 111 60.7 Minus

FMO01067.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:28 Download gff for FMO01067.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6330-RA 127..1225 1..1095 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:37:01 Download gff for FMO01067.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6330-RA 129..1227 1..1095 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:18:12 Download gff for FMO01067.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6330-RA 129..1227 1..1095 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:18:12 Download gff for FMO01067.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 26953004..26953126 1..127 96   Minus
3R 26951775..26951898 128..251 100 <- Minus
3R 26951072..26951419 252..599 100 <- Minus
3R 26950638..26951009 600..968 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:37:01 Download gff for FMO01067.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 22778726..22778848 1..127 96   Minus
arm_3R 22777497..22777620 128..251 100 <- Minus
arm_3R 22776794..22777141 252..599 100 <- Minus
arm_3R 22776360..22776731 600..968 99 <- Minus