Clone FMO01068 Report

Search the DGRC for FMO01068

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:68
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcpa-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01068.5prime Sequence

897 bp (615 high quality bases) assembled on 2008-02-20

> FMO01068.5prime
TGGGACGAAGTTATCAGTCGACATGGAGCAGACACCGATAGGAAGCGGAG
AAGGTGCGCATCGTATCGGACTTCATCCTACATGCGCCGCCCGGCGAGTT
CAACGAAGTGTTCAACGATGTGCGGGAGCTCCTCAAGAATGACACTCTGC
TAAAGGATGGGGCTAGCCACGCCTTCGCCCAATACAACAAGGACCAGCTG
ACTCCGGTTCGCATCGAGGGCACCGATCATAACGCCATCATATCGGAACA
CAACGATCTGGGAAACGGTCGCTTCTACGACCCGCGCACAAAGCAAGCCT
TCAAATACGACCACCTCCGAAAAGAGGCTTCCGACTACCAGGATTTTTAG
GCAGATGCCACTGCGGAGCCCTGGAGGGCGGCCCTCGACCTGGAGACGCT
CGCCTACACTGCCAGTCATTATAGACACGGGGTCAGCTCTGTTTTTGGAA
AGGCGCAGGGCAACCAGATCACCCTGACCATTTGCATCGAAGACCACCAG
TTCCAGCCGAAGAACTATTGGAATGGCCGATGGCGCTCCCAGTGGCATGT
GACCTTCCAGGCGGGCAGCGGAACCGCCGAACTGAAGGGTGTGCTCAAGG
TGCAGGTGCATTACTACGATGACGGCAACGTCCAGCTGGTGTTCCCAAAG
GAGTGCCGCGAAAGCGTGGTGGTCAGCAACGAGCATCCGGTGGCCAGGAG
GTGATCCGTCTGATCGAGGACGCCGAGAATGAGTACCAGCTGGCCATTTC
GGAGAACTATCAGACGATGTCGGACACGACATTCAAGGCAATTGCGTCGC
CAGTTGCCCATCACCAGGACCAAGATCGACTGGAGCAAAATTGTTCCTCG
TATAGCATTGGCAAGGAACTGAGACGCAAGCTAGCTTTCTAGACCAT

FMO01068.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:24:37
Subject Length Description Subject Range Query Range Score Percent Strand
cpa-RA 1918 CG10540-RA 236..1093 23..879 3945 97.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:24:34
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21058611..21059050 431..872 1945 97.5 Plus
2R 25286936 2R 21058022..21058263 23..262 1100 97.9 Plus
2R 25286936 2R 21058383..21058555 261..433 805 97.7 Plus
Blast to na_te.dros performed on 2014-11-28 19:24:35 has no hits.

FMO01068.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:29 Download gff for FMO01068.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10540-RA 222..1091 15..883 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:37:06 Download gff for FMO01068.5prime
Subject Subject Range Query Range Percent Splice Strand
cpa-RA 226..1095 15..883 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:18:17 Download gff for FMO01068.5prime
Subject Subject Range Query Range Percent Splice Strand
cpa-RA 226..1095 15..883 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:18:17 Download gff for FMO01068.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21058612..21059060 432..883 96   Plus
2R 21058384..21058553 262..431 97 -> Plus
2R 21058012..21058262 15..261 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:37:06 Download gff for FMO01068.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16946117..16946565 432..883 96   Plus
arm_2R 16945889..16946058 262..431 97 -> Plus
arm_2R 16945517..16945767 15..261 97 -> Plus