Clone FMO01069 Report

Search the DGRC for FMO01069

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:69
Vector:pMK33-CFH-BD
Associated Gene/Transcriptshrb-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01069.5prime Sequence

729 bp (729 high quality bases) assembled on 2008-03-07

> FMO01069.5prime
ATAAAAAGAAGTTATCAGTCGACATGAGTTTCTTCGGGAAGATGTTCGGC
GGCAAGAAGGAAGTGGCCCCCACCACCGGCGAGGCGATACAGAAGCTGCG
CGAGACGGAGAACATGCTTATCAAAAAGCAGGAGTTCCTGGAGGCCAAGA
TCGAGGACGAACTGAATATAGCCCGCAAGAATGCGTCTAAAAACAAAAGA
GTGGCCCTGCAAGCACTCAAGAAAAAGAAGCGGCTGGAGAAGCAACTCCA
GCAGATCGATGGCACCCTGTCCACAATCGAAATGCAGCGCGAGGCTCTGG
AGAGCGCCAACACAAACACTGCCGTCTTGACCACGATGAAGAATGCCGCG
GATGCCCTCAAGAGAGCCCATCAGAATATGGACGTGGACAAGGTGCACGA
CATGATGGATGACATTGCCGAGCAGCAGGACGTGGCCCGCGAGATTTCCG
ATGCCATTTCGAACCCAGTGGCATTCGGCGCCGATCTGGATGATGAGGAT
CTCGAGCGGGAACTCGACGAGCTGGAGCAGGAGAACTTTGATAAGGAAAT
CATTGGCATACCCGAGCCGACGCCCACATTGCCAGAAGCACCCACAGAAG
ATTTGCCCGAGAAGGCCAAAGAAAAGAAAAAGGCGACAACCACGACTGCC
GTGGAGGATGATGATGATCCAGACATGAAGCAGCTTTTATCCTGGTCCAA
CGCAAGCTTTCTAGACCATTTCGTTTTGT

FMO01069.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:26:28
Subject Length Description Subject Range Query Range Score Percent Strand
shrb-RA 1267 CG8055-RA 118..795 24..701 3390 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:26:26
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 9142713..9143000 667..380 1425 99.7 Minus
2R 25286936 2R 9143058..9143238 380..200 905 100 Minus
2R 25286936 2R 9143620..9143797 201..24 890 100 Minus
2R 25286936 2R 9142618..9142656 701..663 195 100 Minus
Blast to na_te.dros performed 2014-11-28 19:26:27
Subject Length Description Subject Range Query Range Score Percent Strand
baggins 5453 baggins BAGGINS 5453bp 1580..1648 471..536 122 66.7 Plus

FMO01069.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:04 Download gff for FMO01069.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8055-RA 104..794 14..705 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:37:51 Download gff for FMO01069.5prime
Subject Subject Range Query Range Percent Splice Strand
shrb-RA 108..798 14..705 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:19:00 Download gff for FMO01069.5prime
Subject Subject Range Query Range Percent Splice Strand
shrb-RA 108..798 14..705 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:19:00 Download gff for FMO01069.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 9143620..9143807 14..201 97   Minus
2R 9143059..9143236 202..379 100 <- Minus
2R 9142717..9143000 380..663 100 <- Minus
2R 9142614..9142655 664..705 95 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:37:51 Download gff for FMO01069.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 5031125..5031312 14..201 97   Minus
arm_2R 5030564..5030741 202..379 100 <- Minus
arm_2R 5030222..5030505 380..663 100 <- Minus
arm_2R 5030119..5030160 664..705 95 <- Minus