Clone FMO01072 Report

Search the DGRC for FMO01072

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:72
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCHKov2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01072.5prime Sequence

1154 bp (439 high quality bases) assembled on 2008-03-07

> FMO01072.5prime
CCATAAAGACAAAGTTATCAGTCGACATGACTGACCAACCAACTCCACAG
AAAGGTGACCAAGGAGCTATTCAGCAGCTTGTTGGAACAGAGTAATCGAA
ATTTCAAGGCGATCATTAAATTTGTTCCAACATCAGCGATTAGCAAAGGG
GAAAACTATTTGACGATCGTGCTGCGCATACAAATTGAAATGCAGCTGAA
AGATAACAGCATAGAAGATGTCAGCTACATACTGAAGATTCCTTTAGTCC
CGGAAGATGAGAAGAACGACTTCCACGAAATGTTCGATGCCGAACTGGAC
ATGTACGATCATCTGATACCAGAATTGGAGGATCTATATGCCAAAAACAC
TTCCATATCACCAAAATTCAAGCCTGTTCATCTGAAGTTTCCAGGAGAGC
CGGTAAAAAGCGACTACATTCTTTTGGAGGATCTGCGGATGAAGGGATAT
AGGAATGCCGACAGAACCCAGGGATTGGAGCAGTTTGAAGTGGAGGCGGT
CCTCAAGAAGTTGGCACAGTGGCACGCAGCCTCTGCAAAAAGAGTAGTCG
AGCTGGGTGAATACTATAAGGACATCCGGGAGAGTTACTTTTACTACTGA
GCACCAGAAATTACTCGATGAATTCAACATTAATTTTTTGTGTGCCCTTC
CTGGAGTGCATGCAGTAATATTAATCTTGAGCCAGGACAGCTTCGTTCTC
ATAACCGACTATACTCTCAACTGACGAGATCTGAATATTGATTTGGTAAT
ACGATCCTCTGGAGTTATCTGTGTTAAACCACGGAGATTTTGGTGCATTA
CTTTTATGTTCAGTATATATACGCCTCTAAAGTGGAGGATGTTTGTTTTT
GTTGACTTCCAGCTCCCAAATATTGCCCACCCGCCCATAAGACCTCCATG
GCATACTGGTGACCTCCACCTAAGTTTTTCATCCATCTGGGACAATTCGA
CTATTTCTAGAGTTTATTCCACACAGTTAGTCGATCCTCTCTTAGCTCAT
AACTATCGTAATGCACCCACACTACTAGGTTCACGCCCTCTTCACGTAAT
AGGTTTCTGGGTTTTCTATTGCCCCCACGGATGGCTTCCCTTGGTTCTGC
TCTCCGCGCCGAAGGTTTGATCCCCATTAATGGCCATCCTAATTGGGTAA
AAAT

FMO01072.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:01:39
Subject Length Description Subject Range Query Range Score Percent Strand
CHKov2-RA 1450 CG10675-RA 58..1137 27..1102 3865 92.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:01:37
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 25330423..25330921 703..201 2240 98.2 Minus
3R 32079331 3R 25330968..25331146 206..27 805 97.8 Minus
3R 32079331 3R 25330203..25330360 870..715 350 90 Minus
Blast to na_te.dros performed on 2014-11-28 20:01:38 has no hits.

FMO01072.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed on 2008-05-23 17:43:03 has no hits.
Sim4 to dmel-all-transcript-r5.52.fasta performed on 2013-08-04 23:22:34 has no hits.
Sim4 to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 20:49:10 has no hits.
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:49:10 Download gff for FMO01072.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 25330972..25331153 20..202 96   Minus
3R 25330423..25330919 203..703 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:22:34 Download gff for FMO01072.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 21156694..21156875 20..202 96   Minus
arm_3R 21156145..21156641 203..703 98 <- Minus