Clone FMO01074 Report

Search the DGRC for FMO01074

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:74
Vector:pMK33-CFH-BD
Associated Gene/TranscriptDlic-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01074.5prime Sequence

1239 bp (997 high quality bases) assembled on 2008-03-07

> FMO01074.5prime
CAGTCGACATGGCGATGAACAGTGGGACGCAAACGAATGCGCTGACATCA
TCCTTTACCATGAAGAAAAAGGATGCGGCCGCGGAAAAGGAGAACCTATG
GTCGGCGATATTGAATGAAGTACAAACACAGGGCAGCACAAAACTTCCAT
CAAACAAATCTGTACTAGTATTAGGCGACAATGCCACCGGAAAGACGACA
CTCATTGCCAAACTGCAGGGCGTCGAGGATCCGAAAAAGGGTTCCGGCCT
GGAGTATGCCTACATTGATGTCAAGGATGAGTACAGAGACGACATGACGC
GTTTAGGCGTTTGGGTCCTGGACGGTGATCCAGGACACACAAACCTGCTA
CACTATGCGCTCAACGAAACGAACTATGCACACACACTCGTCATCCTCAC
CGTTTCGATGACGCAGCCGTGGGGCTGGCTGGAGCAGCTAAACCATTGGA
TCAAGGTCCTCGGCCAGCACATCGATAGCCTGCAGCTGGACGCCAAAGAG
AAGGAGGCGGCCCGCCAGCGACTGACCACCACGTGGCAGAGCTACTGTGA
GGTGGGCGACGATCTGGATCCAGGCTCCCCCGTCAAGCGGACGATGCGCA
ACAACTCGATCGACGAGGATGACCTGCTGCCGCTGACGGAGGATGCACTA
ATTACAAATCTGGGCCTCGACATCGTTGTTGTGGTCACAAAGACGGACTA
CATGACCACGCTAGAGAAGGAGTACGAGTATCGTGACGAGCACTTTGACT
TCATCCAGCAGTGGATACGTAACTTCTGCCTGCGGCATGGCACTTCGCTC
TTCTACACGAGCGTCAGGAAGACAAGAACTGTGATGTCCTCTACAAGTAT
CTGACGCATCGAATTTATGGTCTACCATTCCGTACGCCAGCGCTAGTCGT
TGAGAACGATGCGGTACTCATTCCGGCTGGCTGGGATAGCCTGAAGAAGA
TTAGTATTTAATACGAAAATATGCATGGAAGTCAAGGCGAAAATCCTAAA
CAGACATTATCAAATCGCCACCAACTAAAAAGGCGGTTTCAATCGCGAAG
CGAATGCAGACGAAGAATGATCAGCATTCCTGCACGCAGACTGAATTCTA
TGCAGGCAACCGGTGCGCGTGGAATACACTTGCAAATCCAAGGCGATAAG
CACCAATAAAAGCGTATCAGAAGTCCGTACACTGGACCAGAGTTTGTACT
CAAAGTATAGTATCTTGAGCGTAGAGCCGACGAAAGGCG

FMO01074.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:24:19
Subject Length Description Subject Range Query Range Score Percent Strand
Dlic-RA 2241 CG1938-RA 347..1434 7..1087 5055 98.2 Plus
Dlic-RD 3715 CG1938-RD 347..1434 7..1087 5055 98.2 Plus
Dlic-RB 3371 CG1938-RB 97..1090 101..1087 4585 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:24:17
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 11161317..11161718 291..692 2010 100 Plus
X 23542271 X 11161781..11162012 691..921 1095 99.1 Plus
X 23542271 X 11161060..11161251 100..291 945 99.5 Plus
X 23542271 X 11155135..11155230 7..102 480 100 Plus
X 23542271 X 11162086..11162198 922..1033 350 89.4 Plus
Blast to na_te.dros performed on 2014-11-28 22:24:18 has no hits.

FMO01074.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:07 Download gff for FMO01074.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1938-RD 347..1415 1..1065 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:01:34 Download gff for FMO01074.5prime
Subject Subject Range Query Range Percent Splice Strand
Dlic-RD 342..1410 1..1065 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:58:09 Download gff for FMO01074.5prime
Subject Subject Range Query Range Percent Splice Strand
Dlic-RD 342..1410 1..1065 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:58:09 Download gff for FMO01074.5prime
Subject Subject Range Query Range Percent Splice Strand
X 11162086..11162192 922..1027 93 == Plus
X 11161783..11162012 693..921 99 -> Plus
X 11161318..11161718 292..692 100 -> Plus
X 11161061..11161251 101..291 99 -> Plus
X 11155130..11155228 1..100 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:01:34 Download gff for FMO01074.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 11056119..11056225 922..1027 93 == Plus
arm_X 11055816..11056045 693..921 99 -> Plus
arm_X 11055351..11055751 292..692 100 -> Plus
arm_X 11055094..11055284 101..291 99 -> Plus
arm_X 11049163..11049261 1..100 97 -> Plus