Clone FMO01077 Report

Search the DGRC for FMO01077

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:77
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG13698-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01077.5prime Sequence

1201 bp (967 high quality bases) assembled on 2008-02-20

> FMO01077.5prime
CAGTCGACATGGCAAAGTCGACACTTTATGCTGCTGGGGTGACCTGTCTG
GGCTTTATTTGCTTCGCCTTGGCATCTGTGGCCATTGGCATACCCATTTG
GGGTTACTACGATAGTCCATCGGGCGGCTATGACTTCGATCGAGGTTATT
TCGGACCGTTTAAGGTCTGCAAGCAATTGACTTATAATCGCGAGAAATGC
GGCAACGACGTGTCCAAGTTTAGATTAAGTAATGCGGTTTTTGTCAGTGG
ACTCTTGGCCATTGGCAGCTCAGCTGTGCTGGGCATCTTCTGCATTCTGT
CGGTCATTCAACACGCGATGATCTCATCCAGGGAGAAGGTGGTTATGCCC
TACACAACTCTAGTGATAGTGAAGTTAATGTTGGCATTGCTGGGAGGTGT
ACTGGCCATCATAGCGACGGTTTTGTTTGCTCTGCAAATTGATGAGCAGG
AGCGCTATGGCTTCAAGATATCGCGGGGCATTTCCTTCTATATACAGATT
GTGGCTATTGTTTTGACAATTGCTCTGTTCGTGGCCGCCCTGTACGATGT
GATCTACTCGCGCAGTCCAGGCGGAGATCCCACAATGGCGCTGGATGTGT
CATCTCCGGGCAGTGCCACTACGTTCAATAATCCTGGTTTCAAGGAGCCT
CGCAGTCGCAACGGCGTTTCGGTGACGGACGCATCCGGTAAGCCCTACAG
CGGAATCCGGAATGGAGCGGGAACGGCGGGCAGCGTGGCCTCCATGAGCA
CCACCGTGACCAGCGTGTCCAATGGATCCACCCTTGACTCGGTGACTCGT
TCACCGCTGCGATCGAGTCTGAGAGCCGAGACCACGGCCGGATCCAACGT
TAGGCATTCAAATCCCGGCTATTTCTGGATCCGGAGCTCGCACCTATGCG
CGCAATGGAAGCGTGAAGAAGGTCCGAATTCAGACGCACAGCACCGAGGT
GGCCAGCTTTCTTAGACCATCGTTGGCGCGCGGGGCCCAGGTAGTGGTAT
AATCATAATCATATCCTATCATAATCCCAACCTAGCCTAGGAGATCCTGT
CATGACTATGGCTGATCTCACCAATAAAAACGCCTGGCGACGACGTTCGA
CAATCGATGGAATTTGAGCTTATCGAATTATCACGGATCACGATCGATCA
TAGCGCCTGCCTCTGAATCGTGAATCTAGCCATTCGCCGCACTGGGACAT
C

FMO01077.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:23:18
Subject Length Description Subject Range Query Range Score Percent Strand
CG13698-RC 1617 CG13698-RC 616..1565 7..951 4580 99.3 Plus
CG13698-RB 2418 CG13698-RB 702..1651 7..951 4580 99.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:23:16
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18089184..18089646 951..494 1990 98.3 Minus
3L 28110227 3L 18090009..18090176 399..232 840 100 Minus
3L 28110227 3L 18090447..18090564 124..7 590 100 Minus
3L 28110227 3L 18090279..18090387 231..123 545 100 Minus
3L 28110227 3L 18089846..18089948 497..395 515 100 Minus
Blast to na_te.dros performed on 2014-11-28 22:23:17 has no hits.

FMO01077.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:32 Download gff for FMO01077.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13698-RB 676..1636 1..956 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:01:04 Download gff for FMO01077.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13698-RB 695..1655 1..956 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:57:43 Download gff for FMO01077.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13698-RB 695..1655 1..956 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:57:43 Download gff for FMO01077.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 18090448..18090571 1..123 97   Minus
3L 18090279..18090386 124..231 100 <- Minus
3L 18090012..18090176 232..396 100 <- Minus
3L 18089846..18089946 397..497 100 <- Minus
3L 18089180..18089642 498..956 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:01:04 Download gff for FMO01077.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18083548..18083671 1..123 97   Minus
arm_3L 18083379..18083486 124..231 100 <- Minus
arm_3L 18083112..18083276 232..396 100 <- Minus
arm_3L 18082946..18083046 397..497 100 <- Minus
arm_3L 18082280..18082742 498..956 97 <- Minus