Clone FMO01079 Report

Search the DGRC for FMO01079

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:79
Vector:pMK33-CFH-BD
Associated Gene/Transcripttmod-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01079.5prime Sequence

1242 bp (750 high quality bases) assembled on 2008-03-07

> FMO01079.5prime
AAAGACGAAGTTATCAGTCGACATGGAGAGTGCCCTGCCGGTGGTCGAGT
TTCAGCAGATAAAGCTGCGTCCGGTGCCAAAGGTCAAACGCCGAGCCCCT
CAGCCGCCAGTGAGCCTTCGCCTGAAGCATAAAAATACTTCTGCCACCAC
AAAGACAACCACGCTCACCACCCCCGCCAAACTGTATGGCAAGGATCTGA
GTGAGTACGATGATGTGGATGTGGAGAGCCTGCTGGCCCAGCTCTCCCCC
GAGGAGATAACCATACTGGCCAAAGAAGTGGATCCCGATGACAACTTCCT
GCCGCCAGACCAGCGCAATAGCTATGAGTGCACCAAGGAAGCCACCGGGC
CTCTCAATCGCAAGCAGCTGATCGAGCACATCAATAAGCAGGCCATCGAG
ACCCCGGATCAGCCGGAGTTCGAGCCGTTCGTTCAGGGCAAGGTTCGTGG
AAAGAAGTGGGTCCCACCGCCAAGGGATGCCCGCGACATCGAGGCCGAAG
AACAAATCGCCATTGACATGGGCGAGGAGTACGAACACGCCCTTAACGAT
GCCACGCAGGAGGAGATCATCGATCTGGCCGCCATCCTCGGCTTCCACTC
GATGATGAATCAGGACCAGTACCACGCCTCCTTGCTCAACAAGGGTCAGC
CCGTGGGTCTGGGATGGTATGGCATTACGAAATCCACTCAGCAGAAGCTC
TTCCCTATGGGATCCGCCCAACAACACAGATGTGTAGGAATCCATCAAGC
GGGTAAGGACGATGACTCCAAGCTGATTGACCTCAACTGAACAACATTAA
TAAACATCTCGGACGAGAACTCGAGCAACTGTTTGCCGCACTGCCTCAGA
ACGAATTTGGCAGTCCTCTCGCTAACAAATGTGGCCTAACGAACGAGACA
GCCCTCCTGTTAGCCGCGTCATAGAAGAAGCAAAACCCTGACAGTATTAA
TGTCGAGACCACCTTTATCATCCGCCCGTGATTGTTAAGTTGGGGCAATG
CCTTGCTTCAATGCCCACCCATCGAGGAGTTAGGCCTTCAATCAGCGCCT
GCGGTCCGGCACAGATTCAGATGGATCACCGACCTGATGGAAAAAACTCT
TCCCTGCCTGTGCCCTTGCCTGAACTGAATTTAAGCAGCTGGCATCGATT
CCCCTCACCCTTCACGTACTTTCTCACGGATATACCGTGTTGTAAGGCTC
CTGTGATACACCGACGCTAATACGAAAGTGACCTTTACTGTT

FMO01079.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:16:25
Subject Length Description Subject Range Query Range Score Percent Strand
tmod-RB 2508 CG1539-RB 160..1261 23..1107 4500 95.2 Plus
tmod-RJ 2753 CG1539-RJ 519..1506 137..1107 3945 94.8 Plus
tmod-RI 3000 CG1539-RI 766..1753 137..1107 3945 94.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:16:22
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 30572023..30572534 290..800 2370 98.8 Plus
3R 32079331 3R 30571809..30571962 137..290 770 100 Plus
3R 32079331 3R 30571316..30571429 23..136 555 99.1 Plus
3R 32079331 3R 30572599..30572834 803..1031 500 88.6 Plus
Blast to na_te.dros performed on 2014-11-28 22:16:23 has no hits.

FMO01079.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:08 Download gff for FMO01079.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1539-RB 150..1261 13..1107 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:41:45 Download gff for FMO01079.5prime
Subject Subject Range Query Range Percent Splice Strand
tmod-RB 150..1261 13..1107 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:03:44 Download gff for FMO01079.5prime
Subject Subject Range Query Range Percent Splice Strand
tmod-RB 150..1261 13..1107 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 23:03:44 Download gff for FMO01079.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 30572023..30572535 290..802 98 -> Plus
3R 30571809..30571961 137..289 100 -> Plus
3R 30571306..30571429 13..136 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:41:45 Download gff for FMO01079.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 26397745..26398257 290..802 98 -> Plus
arm_3R 26397531..26397683 137..289 100 -> Plus
arm_3R 26397028..26397151 13..136 96 -> Plus