Clone FMO01080 Report

Search the DGRC for FMO01080

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:80
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRab5-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01080.5prime Sequence

701 bp (701 high quality bases) assembled on 2008-03-07

> FMO01080.5prime
AGAGGGCAAAGTTATCAGTCGACATGGCAACCACTCCACGCAGCGGCGGG
GCCAGCGGCACTGGAACGGCGCAGCGGCCCAATGGCACCTCGCAGAACAA
AAGCTGCCAATTCAAGTTGGTGCTCCTCGGCGAGTCCGCTGTGGGCAAGT
CCTCACTGGTGCTGCGCTTCGTCAAGGGACAGTTCCACGAGTACCAGGAG
AGCACGATAGGTGCGGCCTTTCTGACACAGACTATTTGCATAGAGGACAC
TGTCGTTAAGTTCGAGATCTGGGACACGGCTGGCCAGGAGCGGTACCACA
GCTTAGCTCCCATGTATTATCGAGGAGCGCAGGCCGCTATTGTCGTCTAT
GATATACAGAATCAGGACAGTTTTCAGCGTGCGAAGACCTGGGTCAAGGA
ACTGCATAAACAAGCCTCACCAAACATTGTCATTGCGCTGGTCGGCAACA
AGGCAGATTTGTCAAACATTCGCGTCGTAGAGTTCGATGAAGCGAAGCAA
TATGCCGAGGAGAACGGGCTGCTGTTCATGGAAACCTCCGCCAAGACGGG
CATGAATGTGAACGACATCTTCTTGGCCATTGCCAAGAAACTACCTAAGA
ACGATGGCGCCAACAATCAGGGAACCCAGCATAAGGTCGACTGGAACCGA
AACAAATCGACCGACGAACAACTGCTTGCAAGGCAAGCTTTTCTAGACCA
T

FMO01080.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:21:31
Subject Length Description Subject Range Query Range Score Percent Strand
Rab5-RI 1775 CG3664-RI 274..931 23..682 3205 99.2 Plus
Rab5-RH 1772 CG3664-RH 275..932 23..682 3205 99.2 Plus
Rab5-RG 1785 CG3664-RG 284..941 23..682 3205 99.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:21:28
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 2361157..2361429 295..23 1350 99.6 Minus
2L 23513712 2L 2360633..2360801 582..414 830 99.4 Minus
2L 23513712 2L 2360971..2361093 414..292 615 100 Minus
2L 23513712 2L 2360477..2360570 676..582 410 97.9 Minus
Blast to na_te.dros performed on 2014-11-28 19:21:29 has no hits.

FMO01080.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:10 Download gff for FMO01080.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3664-RE 250..911 20..682 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:45 Download gff for FMO01080.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab5-RG 280..941 20..682 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:55:45 Download gff for FMO01080.5prime
Subject Subject Range Query Range Percent Splice Strand
Rab5-RG 280..941 20..682 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:55:45 Download gff for FMO01080.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 2361160..2361433 20..292 99   Minus
2L 2360972..2361092 293..413 100 <- Minus
2L 2360633..2360801 414..582 99 <- Minus
2L 2360472..2360569 583..682 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:45 Download gff for FMO01080.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 2361160..2361433 20..292 99   Minus
arm_2L 2360972..2361092 293..413 100 <- Minus
arm_2L 2360633..2360801 414..582 99 <- Minus
arm_2L 2360472..2360569 583..682 97 <- Minus