Clone FMO01081 Report

Search the DGRC for FMO01081

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:81
Vector:pMK33-CFH-BD
Associated Gene/Transcriptshf-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01081.5prime Sequence

818 bp (344 high quality bases) assembled on 2008-03-07

> FMO01081.5prime
AAAAACTAAGTTATCAGTCGACATGACACATCAGGGCATCCCCTGCCTGG
TCAAGTGGTTATATCTGGTGCTGATCGTGCACACGCTCCTCTGCATCGGC
CAGCTCGAGTGTCGCCAGCAGCACCACAATCGGAATAACAATAATAATAA
CAGAAGAGCGGACTCTTCCAGCTCAGAGGAGGGCCACGGCAACACCAGCG
ATGGCGTGGACAACTTCGCAAATCAGGACGCCAGCTTCTTTGGCCATGGA
CACCAGCCGCGTCGGGGTCAACGAAAGAAACAGCAGGGAGGTGGAGGAGG
AGGCAGCGGCGGCGGCGGCGGAAACGGAGGAGGCGGTGGAAGCCTGCACA
ATCGCAACGAGGAGAGCGGTATCTCGTTGTGGATCAATGAGCAGCAGCTC
AAAATGCTTACAGCGCTCTACTTCCCACAGGGCTACTCGGATCGCCTGTA
CGCCATTCACAACAGCCGGGTGACCAATGATCTGAGGGACACGACGCTGT
ACAACTTCCTGGTAATCCCATCGGAGGTCAACTACGTTAACTTCACATGG
AAGTCGGGGCGCCGCAAATACTTCTACGACTTTGACCGCCTGCAGACCAT
GGATGAAAGTATCTTGAAGGCGCCAACGCTGTCCCATTCGCAAGAGCGGA
CGCATTCCGCATGAGCTGATAAATTTTTAGCTTATTCCTGCCCTGCACCG
GCAAAAAGCTCCGGCACCGCGTCCTTCAACGTCGGTCTTAAAATTCCAAA
CGCGCTACAACAAAGCCGCTTCTCGGGCACACCCATTCCCCTCAACTTCA
AAAAAGATTGCGCCCACA

FMO01081.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:25:31
Subject Length Description Subject Range Query Range Score Percent Strand
shf-RD 1745 CG3135-RD 261..1050 23..818 3500 96.5 Plus
shf-RC 1733 CG3135-RC 261..1050 23..818 3500 96.5 Plus
shf-RB 1796 CG3135-RB 261..1050 23..818 3500 96.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:25:29
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 6774561..6774951 413..23 1835 98 Minus
X 23542271 X 6774189..6774444 666..410 1205 98.8 Minus
X 23542271 X 6773969..6774108 818..675 370 90.3 Minus
Blast to na_te.dros performed on 2014-11-28 22:25:30 has no hits.

FMO01081.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:11 Download gff for FMO01081.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3135-RA 261..1049 23..817 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:02:19 Download gff for FMO01081.5prime
Subject Subject Range Query Range Percent Splice Strand
shf-RB 261..1049 23..817 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:58:44 Download gff for FMO01081.5prime
Subject Subject Range Query Range Percent Splice Strand
shf-RB 261..1049 23..817 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:58:44 Download gff for FMO01081.5prime
Subject Subject Range Query Range Percent Splice Strand
X 6774561..6774951 23..413 97   Minus
X 6774183..6774440 414..673 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:02:19 Download gff for FMO01081.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6668594..6668984 23..413 97   Minus
arm_X 6668216..6668473 414..673 98 <- Minus