Clone FMO01082 Report

Search the DGRC for FMO01082

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:82
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG17323-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01082.5prime Sequence

1224 bp (699 high quality bases) assembled on 2008-03-07

> FMO01082.5prime
AAAGGAAAAGTTATCAGTCGACATGTGGTCGCCGCGGGTTGCCCTACTTT
TCCTGGCCCTAGCACTTAGCCAACCGGACGAGTTGGTGGAGGCCGCTGGT
CCGCTGAAGGTGCTGGGTCTTTTTCCCCATCCCGGAGTTAGCCACTTCCA
CTTCTTCCACCCCATCATGAAGGGTCTGGCCGAGGCGGGTCATGACGTGA
GCGTGGTTTCCCACTTCCCGGACAAGCATCCGGTTGCCCACTACAAGGAT
TTCCCCCTCACCGGAATGGACAAGCTCACGAACAGTGTTGATCTCAAGTT
TTTCGAGAAGCGCACATTCTACAGTCACTTCCAGGAGTTCTTCTTGTTGT
ACGACTGGGGCAAACAGACATGCAACCTGACGCTCCGTTCGGAAGCACTG
CAGCAGATCCTCAGGCGTCCGGGACGCTTTGATGTGATCATCATGGAGCA
ATTCAACACTGACTGCATGATGGGAGTGGCCCACCAGCTCCAGGCGCCGG
TGATCGCCTTGAGCAGCTGTGTGATGATGCCCTGGCACTACGAGCGAATG
GGAGCTCCTTTGATACCCTCTCACATCCCGGCGCTCTTCATGGCCCAGTC
GCAGCACATGAACTTTGGGGGACGACTGGCCATTGGTTCAGCACCCACGC
CTTAAATTGGATGTACAAATTACTATCGGTTCCCGCTGCCGACGCCATGG
TTCAATACAAATTCGGCCATGACGTGCCTTTCGGTGGGCGAGCTGGTGAA
GAACACATCCATGTTCTTTGTGAACCATCACTACTCGCTGTCTGGACACA
AAGTAACGCCGCCCAATGTCATCGAGCTGGGTGGCATCCACTTCCAAAAA
TCGAAGCCTCTGCCTGCCGATCTGCACGCATTCTGGATATGCTTGAGGAA
GGATGATCCTTAATTGCTGGGGATCAATGATCGGGCGATTTCCCTGCCGG
CGCGAAATGAATGCATAATTCGGGCGGTGGCCTCAATAAAGTCGAACGTT
ATCCGGAAATCGGAAAAACGACTCTTGCTAACCGCTCTACTTTGCCAATT
AGTGAGGTATGCCAACCGCAATCTTGTCATCCCAAGCCAGTGGTTTCTGT
CTACGCGGAATCTTGGGCCCTTGGAAAGCACTTCTGTGAGATCTCAAGTG
TTCCACCCTATTATGGATACTTTTTGCCATTCGCGCCGTTGTCGAACGAG
CCTGGATATCTACCTCGTAATTTC

FMO01082.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 18:44:40
Subject Length Description Subject Range Query Range Score Percent Strand
CG17323-RD 2212 CG17323-RD 140..1140 23..1017 4360 96.4 Plus
CG17323-RC 1988 CG17323-RC 79..1079 23..1017 4360 96.4 Plus
CG17323-RE 2112 CG17323-RE 203..1203 23..1017 4360 96.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 18:44:39
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 18824795..18825167 297..668 1785 99.2 Plus
2L 23513712 2L 18824306..18824581 23..298 1380 100 Plus
2L 23513712 2L 18825234..18825587 669..1017 1010 89.6 Plus
Blast to na_te.dros performed on 2014-11-28 18:44:39 has no hits.

FMO01082.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2010-07-30 09:24:29 Download gff for FMO01082.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17323-RA 31..1010 23..996 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:19:21 Download gff for FMO01082.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17323-RE 203..1182 23..996 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:35:08 Download gff for FMO01082.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17323-RE 203..1182 23..996 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:35:08 Download gff for FMO01082.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 18825234..18825566 669..996 91   Plus
2L 18824797..18825167 299..668 99 -> Plus
2L 18824300..18824581 13..298 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:19:21 Download gff for FMO01082.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 18825234..18825566 669..996 91   Plus
arm_2L 18824797..18825167 299..668 99 -> Plus
arm_2L 18824300..18824581 13..298 97 -> Plus