Clone FMO01083 Report

Search the DGRC for FMO01083

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:83
Vector:pMK33-CFH-BD
Associated Gene/TranscriptUbcD4-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01083.5prime Sequence

622 bp (606 high quality bases) assembled on 2008-02-20

> FMO01083.5prime
CAGTCGACATGGCGAACATGGCAGTGTCCCGGATCAAGCGGGAGTTCAAG
GAGGTGATGCGCAGCGAGGAGATCGTCCAGTGTTCCATCAAAATCGAACT
GGTCAATGACAGTTGGACGGAGCTGCGCGGCGAGATCGCCGGTCCGCCTG
ACACGCCCTACGAGGGCGGCAAGTTCGTCCTGGAGATCAAGGTGCCCGAG
ACATATCCCTTCAATCCACCAAAGGTACGCTTCATAACGCGCATCTGGCA
TCCGAATATATCGTCGGTTACGGGTGCGATTTGCTTGGACATCTTAAAGG
ACAACTGGGCTGCAGCGATGACACTGCGCACCGTACTGCTGTCGCTGCAG
GCGCTCCTGGCCGCCGCAGAGCCGGACGATCCACAGGACGCAGTGGTGGC
CTATCAGTTTAAGGACAAGTACGATCTGTTCCTGCTTACGGCCAAGCACT
GGACCAACGCGTATGCGGGCGGACCGCACACCTTTCCCGATTGTGATTCA
AAGATCCAACGTCTCAGGGACATGGGCATCGACTAGCATGAGGCGCGCGC
CGTGCTCTCCAAGGACAATTGAAATTTGGAGAAGGCCACCGAGGGCCTGT
TCAGTGCAGCTTTCTAGACTAT

FMO01083.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:14:33
Subject Length Description Subject Range Query Range Score Percent Strand
Ubc4-RC 1709 CG8284-RC 357..954 8..605 2930 99.3 Plus
Ubc4-RB 1473 CG8284-RB 357..954 8..605 2930 99.3 Plus
Ubc4-RA 1107 CG8284-RA 357..954 8..605 2930 99.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:14:31
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 9699344..9699726 223..605 1870 99.2 Plus
3L 28110227 3L 9698964..9699123 70..229 800 100 Plus
3L 28110227 3L 9698692..9698755 8..71 305 98.4 Plus
Blast to na_te.dros performed on 2014-11-28 20:14:32 has no hits.

FMO01083.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:31 Download gff for FMO01083.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8284-RA 348..954 1..612 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:31:59 Download gff for FMO01083.5prime
Subject Subject Range Query Range Percent Splice Strand
UbcD4-RA 354..960 1..612 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:53:50 Download gff for FMO01083.5prime
Subject Subject Range Query Range Percent Splice Strand
Ubc4-RA 354..960 1..612 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:53:50 Download gff for FMO01083.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 9699346..9699732 225..612 98   Plus
3L 9698966..9699118 72..224 100 -> Plus
3L 9698689..9698755 1..71 92 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:31:59 Download gff for FMO01083.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 9692446..9692832 225..612 98   Plus
arm_3L 9692066..9692218 72..224 100 -> Plus
arm_3L 9691789..9691855 1..71 92 -> Plus