Clone FMO01085 Report

Search the DGRC for FMO01085

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:85
Vector:pMK33-CFH-BD
Associated Gene/TranscriptArc-p34-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01085.5prime Sequence

1176 bp (313 high quality bases) assembled on 2008-03-07

> FMO01085.5prime
GAGGGGCAAAGTTATCAGTCGACATGATCCTGCTGGAAATAAAGGCGGAT
TATCGAGGAGACGCTGCTGGTCAAATACCGTAATGCCCAGGCTGGACTCA
AGCCTGAATCGATACACATACGAATAGCAGACTTCGACGGCGTCCTTTAT
CACATTTCCAATGTGAATGGCGATAAAACAAAAGTTCGGATCAGCATATC
GCTGAAGTTCTACAAACAGCTGCAAGAACATGGAGCCGACGAGTTGCTGA
AGCGTGAATATGGCAGTCTGCTTACAGACACGGAAGAAGGCTACAATGTT
TCCGTACTTATCAACCTAGAGGAGATTCCCGAGGACTGCGATCAAATTGC
AAAGAGAATCGGACTGCTGAAGCGCAACTGTTTCACATCGGTTTTTGAAA
AGTATTTTGACTATCAGGAGCAGGGCGAAGAGGGCCAAAAGCGTGCCGTC
ATTAACTACCGCAACGATGAGATTTTATATGTGGAAGCCAAGCCTGATCG
TGTCACCGTCGTCTTTAGTACCATTTTCCGGGACGAAGACGATGTCATTA
TCGGCAAATTATTTATGCATGAATTGAGGGAAGGTCGGCGTGCCTCGCAC
ACCGCACCACAAGTGCTCTTTTCGCACCGAGAACCACCATTGGAATTGGC
CAACACGGACGCTAGGGTGGGCGACAACATTGGCTATGTCACATTCGTAC
TCTTCCCTTCGGCATACCAACAAAGAAACAAGGGACAATACCATTAACTT
ATTTCACATGTTCCGAGATTACTTGCACTACCACATTTAAGTGTTCAAAG
GCTTACATTTCATTCGCGCATGCGAGCAAAAACCTCGGATTTCCTTCAAG
GTGCTAAATCGTGCAATGCCAGAGCCCAAAAATCACCGAGTAGAAAACTA
TAACGAGGAAAACTTTTCAGGCGCATCGAAGCAGCTTTCCTAGACCATTC
GGTTTGGTAGCGCGGGGCCCAGTTAGGTGACCTAATCCTTATCTTTAATC
CTTATTCATAATTACAGACTAGCCCAAGGAAATCTTGGTCCAGGACTAGG
GGTCTGTGAATTCTCACACCAATTAAAAACGCCCCGGGCGGGCAATCGGG
AGCGGTTCTGGAACTAATTTCGAGAAGGGTAGTCTGCGGAGGTCTCTTAT
CATGGGAATTTTATTACCAGGGAGAT

FMO01085.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 23:31:23
Subject Length Description Subject Range Query Range Score Percent Strand
Arpc2-RB 1974 CG10954-RB 537..1439 23..929 4075 97.1 Plus
Arpc2-RA 1941 CG10954-RA 504..1406 23..929 4075 97.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 23:31:21
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 20420897..20421117 477..697 1075 99.1 Plus
2L 23513712 2L 20420646..20420834 288..476 870 97.4 Plus
2L 23513712 2L 20420489..20420590 189..290 510 100 Plus
2L 23513712 2L 20420318..20420412 95..189 445 97.9 Plus
2L 23513712 2L 20422144..20422233 697..787 390 97.8 Plus
2L 23513712 2L 20422300..20422412 790..905 385 94.8 Plus
2L 23513712 2L 20417593..20417667 23..95 265 93.3 Plus
Blast to na_te.dros performed on 2014-11-28 23:31:22 has no hits.

FMO01085.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:15 Download gff for FMO01085.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10954-RA 525..1435 15..929 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:27:05 Download gff for FMO01085.5prime
Subject Subject Range Query Range Percent Splice Strand
Arpc2-RA 525..1435 15..929 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-29 00:15:07 Download gff for FMO01085.5prime
Subject Subject Range Query Range Percent Splice Strand
Arpc2-RA 496..1406 15..929 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-29 00:15:07 Download gff for FMO01085.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 20422302..20422412 792..905 94 == Plus
2L 20422145..20422236 698..791 96 -> Plus
2L 20420897..20421117 477..697 99 -> Plus
2L 20420648..20420834 290..476 97 -> Plus
2L 20420490..20420589 190..289 100 -> Plus
2L 20420319..20420412 96..189 97 -> Plus
2L 20417585..20417667 15..95 91 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:27:05 Download gff for FMO01085.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 20422302..20422412 792..905 94 == Plus
arm_2L 20422145..20422236 698..791 96 -> Plus
arm_2L 20420897..20421117 477..697 99 -> Plus
arm_2L 20420648..20420834 290..476 97 -> Plus
arm_2L 20420490..20420589 190..289 100 -> Plus
arm_2L 20420319..20420412 96..189 97 -> Plus
arm_2L 20417585..20417667 15..95 91 -> Plus