Clone FMO01087 Report

Search the DGRC for FMO01087

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:87
Vector:pMK33-CFH-BD
Associated Gene/TranscriptAP-47-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01087.5prime Sequence

723 bp (675 high quality bases) assembled on 2008-02-20

> FMO01087.5prime
TCCGAAGGGATTTCAATAACTTCGGAAAAGAAAATTTAAAAAAAGGAAGT
TTTTCAGTTCCAAATGTTTTTTCCTGGGCGATTTTTCCTTTTATGGGGAA
ATTAAAAGGGGAAAGGGGGGGTTTTAAATTTTTCGGGGAAAAAATCCCCC
GGGGGGGGGGACCACATTTTCACAAGGGGGGCCGGGGGGATTTCCAAAAA
ATTTTTTTGGCCCCTTTTTTTTTAAAAAAAAAACCCCCCCAAAAAAAAAA
GGGGGGCTTAAAAACCCCCCCCCCAACTCCTTTTAAAAAGGGGGGGGGAA
AAAAAAAAATTTGTTGTCCCCTTTTTTAAAAAAAAAAAAAAAATTTTTCT
TTTTTTTTTTTTTTTTTCCCCCCCCGCGGGGGCCAAAAAAAAAAAAAAAA
AAAAAAAGGGGGGGGGGGGGGGTTTTTTTTTTTTTTGAAAAAAAAAAAAA
AAAAACGGGGTTTTTTTTTTTGGGGAAAAATCCCCCCCCGGGGGGGAAAA
AAAGAAAAAAAACCCCCCCCCCTTTAAAAAAAATTTTTTTTGGGCCCCCC
CCCCCCCCCCCGGGGGGGGGGGGGGAGGGAGAGGTTTTTTTTTTTTTTTG
CCCCCCCCCCCAAAAACAACCCCCAAAAAAAAAATATAGCAAGAGATAAT
ATTTTTTTGGGGGGGGGGGGGGGGGTGGTTGTTTTTTTTTTCCTGTTGCT
ACCCCCGGGGAAAAAAAAATATA

FMO01087.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 22:16:04 has no hits.
Blast to na_all.dmel.RELEASE6 performed on 2014-11-28 22:16:02 has no hits.
Blast to na_te.dros performed on 2014-11-28 22:16:03 has no hits.

FMO01087.5prime Sim4 Records

Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 23:03:37 has no hits.
Sim4 to na_all.dmel.RELEASE6 performed on 2014-11-28 23:03:37 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-05 00:46:48 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2013-08-05 00:46:48 has no hits.
Sim4 to na_arms.dmel.RELEASE5 performed on 2010-07-30 09:24:31 has no hits.