Clone FMO01088 Report

Search the DGRC for FMO01088

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:88
Vector:pMK33-CFH-BD
Associated Gene/TranscriptArp11-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01088.5prime Sequence

1230 bp (1023 high quality bases) assembled on 2008-02-20

> FMO01088.5prime
CAGTCGACATGCCCATTTACGAGAGCGTGATGCAGGAGAAGCCGCCCATT
GTCCTCGACATTGGCACCGCCTACACCAAGCTGGGATTCGCAGCGGAGGC
GTATCCGCGCAAGATCATGCCCACGGAGGTGGTGATGACCACGACGGGGA
TCCGGAAGCGTCTGTTCGACTACGACACTCCGGAGGAGCTGTACGACCAG
CTAGTGGATTTTCTGCAGACGATCTTCTTCAAGCATCTACTGGTCAGCCC
CAAGGAGCGCAAGTTCGTGCTGGTGGAGAACGTGTTCGGATCCACTGTGC
TGCGTGAAACCTTGGCCCGCGTGCTCTTTGTCCACTTCGACGTCTCCTCC
GTGCTGTTCGTGCCCGTGCATCTCATTGCGCTGTCTACGCTGGCAGTGCC
CACTGCCCTTGTGGTGGACGTTGGTTACAGCGAGACCAGCGTTATGCCCG
TCTTCAGCGGGGTGCAAATCATGGCCGCCTTCAAGGATCAGAGCTACGGA
GGCAGCGCCATCCACGCGGAGATCAAGCGGCAGCTGGTTGAGAGTGGCGT
TAAGGAGAGCCTGCTAACAGAAAGCGTGCTGGAGGACATCAAGGTGCGAA
CCTGCTTTGTGACCACCATGGAAAGAGCCAAGGCCCGCGCCAACGGCGAC
GAGAATCAGCCGACTCCCGCGCCAGACGTGGACTACATTGTCAGCGACAA
CGATGCGGTCATCCAGGTGCCCGGCCTCCTGCGGGAGTCTGCCTACGAGA
TCATGTTCGAGGCCAGCAACGAGCGGGACAGCCTGCCGCATCTCATCCTG
CGCTCCATTCTCGACTGCACACTAGACGTGCGACGTGCCCTGATCGAGAG
TGTGTTCCTCGTGGGCGGCGGCTCATGGTCCAGGGTCTGCTGGCTCGCCT
CCGCCAGGAGCTGCAGCATCTGCTCACCGAGGATCCGTTCTACGCCGAAC
GCTTCCATGCGAGCTGCAGTTCAAGTTTTCATGCTGTCGGCAAGCAAACT
TTACTGCCTGGCTGGGCGGCGCCTGGGGCGGGGCGACGGATCTCCATCCA
ACCCGATCGCTGGTCAAGGAAGACGGTATCTAAGAGCGAGCCGGTTCCGA
CTGGACACCTTTGTGATAATAGGCCGACGGTCGCAGCTTCCAGACATCGT
TGGCCGCGGGCAGGTAATTCCTATCTAACTATTAATCTAATCAACTTTGC
CTAGGAACCTGTGCTCAGACTAGGTCGTGT

FMO01088.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:20:38
Subject Length Description Subject Range Query Range Score Percent Strand
Arp10-RB 1536 CG12235-RB 261..1387 9..1128 5160 97.9 Plus
Arp10-RA 1374 CG12235-RA 99..1225 9..1128 5160 97.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:20:35
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 19644740..19645582 1070..233 3805 97.9 Minus
X 23542271 X 19645632..19645785 233..80 770 100 Minus
X 23542271 X 19645845..19645916 80..9 360 100 Minus
Blast to na_te.dros performed 2014-11-28 19:20:36
Subject Length Description Subject Range Query Range Score Percent Strand
aurora-element 4263 aurora-element DMAURA 4263bp Derived from AB022762 (d1268008) (Rel. 59, Last updated, Version 1). 1107..1189 988..908 112 64.3 Minus

FMO01088.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:40:33 Download gff for FMO01088.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12235-RA 123..1267 1..1136 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:33 Download gff for FMO01088.5prime
Subject Subject Range Query Range Percent Splice Strand
Arp10-RA 91..1235 1..1136 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:55:19 Download gff for FMO01088.5prime
Subject Subject Range Query Range Percent Splice Strand
Arp10-RA 91..1235 1..1136 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 19:55:19 Download gff for FMO01088.5prime
Subject Subject Range Query Range Percent Splice Strand
X 19645846..19645924 1..79 96   Minus
X 19645633..19645785 80..232 100 <- Minus
X 19644670..19645582 233..1136 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:33 Download gff for FMO01088.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 19539879..19539957 1..79 96   Minus
arm_X 19539666..19539818 80..232 100 <- Minus
arm_X 19538703..19539615 233..1136 97 <- Minus