Clone FMO01089 Report

Search the DGRC for FMO01089

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:89
Vector:pMK33-CFH-BD
Associated Gene/Transcriptdlg1-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01089.5prime Sequence

654 bp (654 high quality bases) assembled on 2008-02-20

> FMO01089.5prime
CAGTCGACATGCCAGTGAAAAAGCAAGAAGCTCATCGGGCTCTCGAGCTG
CTCGAGGACTACCACGCGAGACTTTCGGAGCCGCAGGATCGGGCGCTGCG
TATTGCAATCGAACGCGTTATACGCATATTTAAATCTCGCTTGTTTCAAG
CGCTGTTAGATATACAAGAATTCTATGAATTGACATTATTGGATGACTCG
AAGAGCATACAACAAAAGACAGCGGAGACCTTGCAAATTGCAACCAAATG
GGAAAAGGATGGCCAGGCAGTCAAAATAGCTGATAATCAGCGCATGCGCA
TCGAATCGGACACGGAAAATGCCAAGGAGCCAACTGTCGAGCAGCAGCAA
AAGCAGCAGCAAGCGCAGCAGCGCAGTTCCCGCTCCCCGCAGCAGCAGAA
TCCGCAGCAGCAGCAGGGATCCAAATCGAGGAGCGGGTCCCAGACTTCAC
AGATACAGATACAGTCACTTACACAGACATACCCAAACGCACACCAGCGC
AAGCGAGTCCTCGTGAGCCTCCATCCACATCAACATCAACATCAAAGCCA
AATTCAACACCAACACCATTACCAACTTCGCCATAACAACGGCATTCAAG
CCAAAATGCTTAAGCGCGCTTTTGAGTCCACCGCAAGCTTTCTAGACCAT
TCGC

FMO01089.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:27:25
Subject Length Description Subject Range Query Range Score Percent Strand
dlg1-RI 2114 CG1725-RI 371..994 9..632 3120 100 Plus
dlg1-RJ 2102 CG1725-RJ 359..982 9..632 3120 100 Plus
dlg1-RC 2554 CG1725-RC 811..1434 9..632 3120 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 21:27:23
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 11387986..11388171 447..632 930 100 Plus
X 23542271 X 11387772..11387933 285..446 810 100 Plus
X 23542271 X 11376840..11376973 26..159 670 100 Plus
X 23542271 X 11381854..11381980 158..284 635 100 Plus
Blast to na_te.dros performed 2014-11-28 21:27:24
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2285..2538 320..576 222 57.7 Plus
Doc3-element 4740 Doc3-element DOC3 4740bp 549..634 522..606 130 62.8 Plus
rover 7318 rover ROVER 7318bp 1930..1997 537..604 123 68.1 Plus

FMO01089.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed on 2010-07-30 09:24:10 has no hits.
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 00:33:18 Download gff for FMO01089.5prime
Subject Subject Range Query Range Percent Splice Strand
dlg1-RC 805..1440 1..641 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:23:19 Download gff for FMO01089.5prime
Subject Subject Range Query Range Percent Splice Strand
dlg1-RC 805..1440 1..641 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:23:19 Download gff for FMO01089.5prime
Subject Subject Range Query Range Percent Splice Strand
X 11387986..11388177 447..641 97   Plus
X 11387772..11387933 285..446 100 -> Plus
X 11381856..11381980 160..284 100 -> Plus
X 11376842..11376973 28..159 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 00:33:18 Download gff for FMO01089.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 11282019..11282210 447..641 97   Plus
arm_X 11281805..11281966 285..446 100 -> Plus
arm_X 11275889..11276013 160..284 100 -> Plus
arm_X 11270875..11271006 28..159 100 -> Plus