Clone FMO01091 Report

Search the DGRC for FMO01091

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:91
Vector:pMK33-CFH-BD
Associated Gene/TranscriptIap2-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01091.5prime Sequence

1236 bp (866 high quality bases) assembled on 2008-03-07

> FMO01091.5prime
AAAAACAAAGTTATCAGTCGACATGACGGAGCTGGGCATGGAGTTGGAGA
GCGTTCGCCTGGCGACATTTGGGGAATGGCCCCTGAATGCCCCAGTTTCC
GCGGAGGATCTGGTCGCCAATGGTTTCTTTGCCACGGGAAACTGGCTGGA
GGCCGAGTGCCATTTCTGCCACGTGCGCATCGACCGCTGGGAATACGGCG
ATCAAGTGGCGGAGCGCCATCGCCGCTCCTCGCCCATCTGCTCCATGGTT
CTGGCTCCCAATCACTGCGGCAATGTTCCCAGGAGCCAGGAGAGCGACAA
CGAGGGAAACAGCGTAGTGGACAGCCCGGAGTCCTGCTCTTGTCCCGATC
TCTTGTTGGAGGCCAATCGCTTGGTAACTTTCAAGGACTGGCCGAATCCC
AACATCACGCCGCAGGCTCTGGCAAAGGCAGGTTTTTTTTTTCCTGAACC
GTCTGGATCACGTGAAGTGTGTTTGGTGCAACGGAGTGATTGCCATGTGG
GAGAAGAACGACAATGCCTTTGAAGAGCACAAGCGCTTTTTTCCCCAATG
TCCTCGTGTGCAAATGGGCCCCCTTATAGAGTTTGCCACCGGGAAGAACC
TGGATGAGCTGGGCATCCAGCCCACCACTCTGCCACTGCGTCCCAAGTAC
GCCTGCGTGGACGCCAGATTGAGAACCTTCACCGATTGGCCCATTTCCAA
TATTCAGCCCGCTTCGGCTTTGGCGCAGGCTGGCCTATATTATCAGAAAA
TAGGCGACCAGGTGCGCTGTTTCCACTGCAACATTGGATTGCGCTCCTGG
CAGAAGGAGGACGAGCCGTGATTCGAACACGCCAAGTGGTCGCCAAAGTG
TCAGTTCGTTTTGCTGGTCAAGGGTCCAGCCTATGTAAGCGGAGTGCTCG
CGACACAGCTGCCATCGTCAGTTCCCAGCCAGCAACTGCTCCGGCTTCAA
CGACTCCAGCAGACGTACTGATGATGAAGCTCCGGCCAGGAGGCCTTAGC
TTGGGTATCGATGGAGGAGTTGTGCGCAATGCCATCCAGCGCAGCTTCTT
GAATCTGGCTGCCTTCTCTAGGATGGACGAACTATTGCATTGACTCTTTG
GACGATGCGGGCGCCAGGACTCTGCACTGAAGGTGCGCGGAGCCCCGGGA
CCCAGGCCTCTTTTTTGAACCTGTCAGGCCTCCCACAGAGGCTAGACTCT
GGTCCATATCGGGTGGGCATTCTCCTTCTAGCCAGA

FMO01091.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:26:39
Subject Length Description Subject Range Query Range Score Percent Strand
Diap2-RB 1997 CG8293-RB 39..1202 23..1180 4950 96.1 Plus
Diap2-RA 2106 CG8293-RA 148..1311 23..1180 4950 96.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:26:37
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 15933095..15933820 1114..394 2805 94.9 Minus
2R 25286936 2R 15934199..15934570 394..23 1845 99.7 Minus
Blast to na_te.dros performed on 2014-11-28 19:26:38 has no hits.

FMO01091.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:17 Download gff for FMO01091.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8293-RB 39..1172 23..1154 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:37:58 Download gff for FMO01091.5prime
Subject Subject Range Query Range Percent Splice Strand
Iap2-RA 148..1281 23..1154 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:19:04 Download gff for FMO01091.5prime
Subject Subject Range Query Range Percent Splice Strand
Diap2-RA 148..1281 23..1154 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:19:04 Download gff for FMO01091.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 15934199..15934570 23..394 99   Minus
2R 15933058..15933819 395..1154 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:37:58 Download gff for FMO01091.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 11821704..11822075 23..394 99   Minus
arm_2R 11820563..11821324 395..1154 94 <- Minus