Clone FMO01092 Report

Search the DGRC for FMO01092

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:10
Well:92
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG4973-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01092.5prime Sequence

1058 bp (886 high quality bases) assembled on 2008-03-07

> FMO01092.5prime
AAAAACAAAGTTATCAGTCGACATGTCGGAAGAAGCGGCTAGCACCTCGT
CCTTTGGCTTCAAGAAGCGGAACCTCAAGAAGGGAGCTGGAATTCGTCGC
AAAAAGGAAACCAGCAGTGATGAATCTGCAAAAAGCAGCGATGAAGAGAC
CAAAGGCAAAGCCAGTGCTCTGGTGCGAGCCGAGAACCGCCGAAAGCGCA
CGAATCCCAACTTCCAGAGCACCAAGACAATGAGCAAAGCAAAGAGACAG
GCGGGAGGAGTTGGTGATGATGGCTCATCCTCAGCCTCCGACGATGATAA
ACTGGGCATTGCGTACAAATCCAAACGCGAGGCGCTGCCCAGTGGACCCC
AAGATCAGGGAGCTACATCGATTAACGAAATGGACACAGAATTGGATCGC
GATGCGCAGGCAATTCATGCGCGAGCTCTGAAAATCAACGAAGAGCTGGA
GGGCAAGGCGGACGATAAGATCTATCGCGGAATTAACAACTATGCGCAGT
ACTACAAGAAGCAGGATACAGCGGCAGGGAATGCCAGCTCCGGAATGGTA
CGAAGTGGCCCAATTAGGGCTCCTGCCTATCTTAGGGCCACTGTCAGGTG
GGATTATCAGCCGGATATATGCAAGGATTACAAGGAAAACAGGATATTGC
GGCTTTGGCGACAGCTGTAAGTTTCTGCACGATCGCAGTGATTACAAAGC
GGGCTGGCAATTGGAAATGGATCACGAAAATCAGCGAACGGGTGATGTAG
ACTCCGATGGCGATGATACCAAGTATGAGATTCACTCCGATGAAGAAACA
CTGCCTTTCAGTGCCACATCTGCCGACAGAGGTTTGTCAATCCCGTGGAT
AACAAAGTGCAAGCACTATTTCTGTGAAAGGTGCGCCTTGGCCCAATACA
AAAAGTCCACAGCGCTGCATCATCCTGTTCCCAGCAAACAATTGGTATTT
TTCATCCCCGCCAAAGAACTGATACCTCCCCTCAAGACAACCTAATGAAA
ATTCGATAGTGATGAAGGAAGAGGAATTTGGGCAAAAGGAGGATAAGCCG
AAGCAGGG

FMO01092.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:25:41
Subject Length Description Subject Range Query Range Score Percent Strand
mdlc-RA 1419 CG4973-RA 107..1141 23..1058 4705 97.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 22:25:39
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20058017..20058737 128..848 3480 99.4 Plus
3R 32079331 3R 20057854..20057959 23..128 530 100 Plus
3R 32079331 3R 20058812..20059000 857..1046 440 89.1 Plus
Blast to na_te.dros performed on 2014-11-28 22:25:40 has no hits.

FMO01092.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:43:18 Download gff for FMO01092.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4973-RA 103..1139 20..1058 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-05 01:02:25 Download gff for FMO01092.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4973-RA 105..1141 20..1058 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 22:58:49 Download gff for FMO01092.5prime
Subject Subject Range Query Range Percent Splice Strand
mdlc-RA 105..1141 20..1058 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 22:58:49 Download gff for FMO01092.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 20058018..20058744 129..856 99 -> Plus
3R 20057852..20057959 20..128 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 01:02:25 Download gff for FMO01092.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15883740..15884466 129..856 99 -> Plus
arm_3R 15883574..15883681 20..128 99 -> Plus