Clone FMO10002 Report

Search the DGRC for FMO10002

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:2
Vector:pMK33-CFH-BD
Associated Gene/Transcriptfax-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10002.5prime Sequence

862 bp (862 high quality bases) assembled on 2010-10-30

> FMO10002.5prime
CAGTCGACATGGCCCTCAATGTCGATCATAAGATGCGTTTCCGCTCCAAG
AAGGGTCAGCTGCCGTTCATCGAGCTGAATGGGGAGGAAATCGCCGATTC
GGCCATCATCATCAAGGAACTGTCGTCCAAATACGAGAAGTACCTGGACT
CGGGACTCACCGCCGAGCAAAGGAATGTCTCGTACGCCACGATTGCCATG
CTGGAGAACCATCTCATCTGGATCATCTTCTACTGGCGCGCCAAGTATCC
GGACAATGTGCTCAAGGGCTACAAGGTCAACTTGCAGCACGCCCTCGGCC
TGCGGCTGCCCAACTCGATTCTGAACTTCTTCTTTAAGATCACCTTTGGT
CGCAAGGGCACGAAGAAGCTGAAGGCGCACGGCATCGGTGTCCACAGCGC
CGAGGAGATCGAGGAGTTCGGCAAGGACGACCTGAAGGTGCTCAGCGAGA
TGCTCGACTGCAAGCCTTTCTTCTTCGGCGACGAGCCCACCACCCTGGAT
GTGGTGGCCTTCGCTGTCCTCTCGCAGCTCCACTATCTGTCCAAGGACAT
TGCGTATCCGCTGCGCGACTACATGACCGAGAAGTGCCCCAACTTGATTG
GCCACGTATCTCGCATGAAGGACAAGTGCTTCCCCGACTGGGACGAGATC
TGCACGAAGCTGGACCTCAATGCGCACATTCCCAAGCCAGAGCCCGAGAC
CAAGGAGGGCAAGGAGGGTGGCGAGCAGGAGAAATCAAACGAACAGGAGG
GCACTGAGGGCGACAAGATCGAGAAGGAGTTGGAGAAAGACAAGTCAAAC
GAGAAGGAGTCGACCGAGGAGAACAAAGAGAAGAGGAAACAAAGGCAAGC
TTTCTAGACCAT

FMO10002.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:42
Subject Length Description Subject Range Query Range Score Percent Strand
fax-RD 3274 CG4609-RD 114..950 9..844 4145 99.8 Plus
fax-RE 3209 CG4609-RE 58..885 18..844 4100 99.8 Plus
fax-RC 3153 CG4609-RC 784..1611 18..844 4100 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:39
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 16407020..16407359 357..18 1700 100 Minus
3L 28110227 3L 16405501..16405838 692..355 1690 100 Minus
3L 28110227 3L 16405326..16405428 794..692 500 99 Minus
3L 28110227 3L 16405120..16405172 844..793 215 98.1 Minus
Blast to na_te.dros performed 2014-11-26 15:10:40
Subject Length Description Subject Range Query Range Score Percent Strand
gypsy3 6973 gypsy3 GYPSY3 6973bp 4503..4564 180..242 114 66.7 Plus

FMO10002.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:24 Download gff for FMO10002.5prime
Subject Subject Range Query Range Percent Splice Strand
fax-RD 110..952 9..852 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:05 Download gff for FMO10002.5prime
Subject Subject Range Query Range Percent Splice Strand
fax-RD 110..952 9..852 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:10 Download gff for FMO10002.5prime
Subject Subject Range Query Range Percent Splice Strand
fax-RD 114..956 9..852 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:10 Download gff for FMO10002.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 16407021..16407359 18..356 100   Minus
3L 16405502..16405836 357..691 100 <- Minus
3L 16405326..16405428 692..794 99 <- Minus
3L 16405114..16405170 795..852 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:05 Download gff for FMO10002.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 16400121..16400459 18..356 100   Minus
arm_3L 16398602..16398936 357..691 100 <- Minus
arm_3L 16398426..16398528 692..794 99 <- Minus
arm_3L 16398214..16398270 795..852 91 <- Minus