Clone FMO10007 Report

Search the DGRC for FMO10007

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:7
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRtnl1-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10007.5prime Sequence

632 bp (632 high quality bases) assembled on 2010-10-30

> FMO10007.5prime
CAGTCGACATGTCGAACAGATTGTTGGAATCCCTTATCTACTGGCGCGAT
GTGAAGAAATCCGGCATTGTCTTCGGCGCTGGCCTGATCACACTGGCGGC
CATCTCCAGCTTCTCGGTGATCAGCGTGTTCGCCTACTTGTCGCTCCTAA
CCCTCTTCGGCACCGTCGCCTTCAGAATCTACAAATCTGTGACACAGGCC
GTGCAAAAGACAAACGAGGGTCACCCCTTTAAGGATTACCTGGAGCTGGA
TCTGACGCTGTCGCACGAAAAGGTACAGAACATTGCCGGCGTGGCTGTGG
CACATATCAATGGCTTCATCTCCGAGCTGAGGCGTCTGTTTCTTGTTGAG
GATATCATCGATTCGATCAAGTTCGGCGTCATTCTGTGGGTCTTCACCTA
CGTGGGTGCCTGGTTCAATGGCATGACTCTGGTCATCTTGGCCTTTGTCT
CGCTGTTTACCTTGCCCAAGGTCTACGAGAACAACAAGCAATCGATCGAC
ACTCACTTGGATCTGGTGCGCAGCAAATTGACAGAAATCACCGACAAGAT
CCGAGTGGCCATCCCCATTGGCAACAAGAAGCCCGAGGCCGCTGCCGAGT
CTGAGAAGGACAAGGCAAGCTTTCTAGACCAT

FMO10007.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:49
Subject Length Description Subject Range Query Range Score Percent Strand
Rtnl1-RC 1267 CG33113-RC 92..697 9..614 3030 100 Plus
Rtnl1-RF 2700 CG33113-RF 1535..2130 19..614 2965 99.8 Plus
Rtnl1-RG 2271 CG33113-RG 277..868 23..614 2960 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:47
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 4994508..4994716 441..233 1045 100 Minus
2L 23513712 2L 4994786..4994994 233..25 1045 100 Minus
2L 23513712 2L 4994338..4994445 548..441 540 100 Minus
2L 23513712 2L 4994211..4994277 614..548 335 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:10:48 has no hits.

FMO10007.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:25 Download gff for FMO10007.5prime
Subject Subject Range Query Range Percent Splice Strand
Rtnl1-RC 68..678 9..619 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:08 Download gff for FMO10007.5prime
Subject Subject Range Query Range Percent Splice Strand
Rtnl1-RC 92..702 9..619 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:14 Download gff for FMO10007.5prime
Subject Subject Range Query Range Percent Splice Strand
Rtnl1-RC 92..702 9..619 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:14 Download gff for FMO10007.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 4995376..4995391 9..24 100   Minus
2L 4994787..4994994 25..232 100 <- Minus
2L 4994508..4994716 233..441 100 <- Minus
2L 4994339..4994444 442..547 100 <- Minus
2L 4994206..4994277 548..619 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:08 Download gff for FMO10007.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 4995376..4995391 9..24 100   Minus
arm_2L 4994787..4994994 25..232 100 <- Minus
arm_2L 4994508..4994716 233..441 100 <- Minus
arm_2L 4994339..4994444 442..547 100 <- Minus
arm_2L 4994206..4994277 548..619 97 <- Minus