Clone FMO10008 Report

Search the DGRC for FMO10008

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:8
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG13594-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10008.5prime Sequence

1127 bp (1032 high quality bases) assembled on 2010-10-30

> FMO10008.5prime
CAGTCGACATGGCCCAGACGATGGACGACATGGTCTTCCAGTGCAGCAAT
CAAAACTCGATCTATGTGCTGAATGCCAGCTACGGTTCCTATGGGGACTA
TGGCACATATGCGGCAACAAAGCGTGAAATAAATGGCAGCCGGAGCAGAG
CAGCAAATCCAATTGGGTCGACTTGCTCGAGTGGCGTCCTGCAGCATAAA
TTCAAAACTTTCGGCAGTGCCGCAGCAACAGCAGCAGCCGCGGCAGCTGC
AGCGCCACCAGCCATGGATGCAGCAGCGGGAGGCGCAGCAAACTACGTAA
ATCCTGTCGCTACATCAATGTCAACCGCAATGTGTTCACCGGCAACGGCG
GCAACGGCGGCCCTGCAAAAACTGTTCAATTGCAGCGTCGGCGTCGCCTG
CCAAAATGTCACCCACGCCCACAGCAACCACACCAACCAAGGCAGCAGCA
GCATCAGCAGCAGCCACATCCACATCAGTGGCAGCAACAACAATGCCGCC
GCCAGCAACCATAACAATAGCTGCCTGTCGGCGGCAGGCGGAGTGGGCCT
CCAAGGCGCCCGGAATCGGAGCCGGAGTGGCGAATGCCTCGATGGCGCGG
CGGGAGCGGTTACCTCGCCAGCCGGAGGCGGAGGAGCAGGTGGCCTCCCT
CTGCTCCCAAAGAAGAAATGCACCAATGTCAAATCAGCGCTTATTGCCAA
GAAGACAAAGTTTCTCAAATATCTCGAAGAAGAAAAATGGCGCAGCAACG
CGGCAGTTCCGGAAGATGCTGGTGCCATCAGCAATGAGGCGGAGCCATCC
ACCCCGAGCGGCAACAACAACGGCGGCAACTTGAAAAATCAGAGCAACAG
TCGGGAGGCTGGAAGTGGCACTGGAAGTGGCAGTGGAAGTGGATGTGGAA
GTGGGGGGCAGCCGAACAAACCGACCAACTGGAGCATGCATAATGATGAC
ACCAGCACGTCGCTGGGCCAGCACAGCAACTACAACAGCAGCGAAATCGA
GTCCGAGCTCTACAGAGCAGCCGACATTTTGGGCCTGGTGCAGCCTTCTG
TGATATTGCCGATGCTGACTGCGAGCGCTACTTGACTGCACGACGACGAT
GAAAGCTACCTCGCCAATCCGTAATGA

FMO10008.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:54
Subject Length Description Subject Range Query Range Score Percent Strand
CG13594-RB 2855 CG13594-RB 636..1751 9..1109 5095 98.1 Plus
CG13594-RA 2896 CG13594-RA 677..1792 9..1109 5095 98.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:50
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 24623673..24624359 781..95 3435 100 Minus
2R 25286936 2R 24621390..24621654 1037..779 975 94.7 Minus
2R 25286936 2R 24624459..24624543 96..12 425 100 Minus
Blast to na_te.dros performed 2014-11-26 15:10:53
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2316..2427 410..521 254 69.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2400..2667 220..494 251 57.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6731..6965 310..533 248 60.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2268..2505 290..524 246 58.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6704..6921 304..516 241 58.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6739..6880 382..526 241 66 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2334..2439 410..524 202 69.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6692..6836 389..524 190 63.4 Plus
roo 9092 roo DM_ROO 9092bp 1079..1187 419..528 188 66.1 Plus
roo 9092 roo DM_ROO 9092bp 1079..1153 443..517 168 69.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1502..1598 419..521 166 68 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2740..2885 410..554 149 62 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1518..1584 458..524 146 68.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..6818 431..524 145 62.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2373 451..521 132 67.6 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 120..217 444..540 118 59.2 Plus
TART-B 10654 TART-B DM14101 10654bp Derived from U14101 (g603662) (Rel. 42, Last updated, Version 1). 9150..9247 444..540 118 59.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6785 453..521 113 69 Plus

FMO10008.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:25 Download gff for FMO10008.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13594-RA 672..1802 1..1119 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:09 Download gff for FMO10008.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13594-RA 673..1803 1..1119 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:16 Download gff for FMO10008.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13594-RA 673..1803 1..1119 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:16 Download gff for FMO10008.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 24624460..24624548 3..95 95   Minus
2R 24623673..24624358 96..781 100 <- Minus
2R 24621348..24621651 782..1073 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:09 Download gff for FMO10008.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 20511983..20512071 3..95 95   Minus
arm_2R 20511196..20511881 96..781 100 <- Minus
arm_2R 20508871..20509174 782..1073 94 <- Minus