Clone FMO10009 Report

Search the DGRC for FMO10009

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:9
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPyK-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10009.5prime Sequence

935 bp (935 high quality bases) assembled on 2010-10-30

> FMO10009.5prime
CAGTCGACATGGTGAACGTAACCATCTACGATGAGGCACCGCAGCTGAAG
CCCAACGAAGTACCCCAAAACATGGCCGCAGGAGCTGATACCCAACTGGA
GCACATGTGCCGTCTGCAGTTCGACTCGCCAGTGCCCCATGTGCGTCTGT
CCGGAATCGTGTGCACCATCGGACCTGCCTCCAGCAGCGTGGAGATGCTG
GAGAAGATGATGGCCACCGGCATGAACATCGCGCGCATGAACTTCTCTCA
CGGATCGCACGAGTACCATGCCGCCACCGTGGCCAATGTGCGCCAGGCGG
TGAAGAACTACTCGGCCAAGCTGGGCTACGAACACCCCGTGGCCATTGCC
CTGGACACCAAGGGGCCCGAGATCCGTACCGGTCTGATCGGAGGCAGCGG
CACCGCCGAGATTGAGCTGAAGAAGGGCGAGAAGATCAAGCTGACCACCA
ACAAGGAATTCCTGGAGAAGGGCTCTCTGGAGATTGTGTACGTGGACTAC
GAGAACATTGTCAATGTGGTGAAGCCCGGCAACCGGGTGTTCGTCGATGA
CGGTCTGATCTCACTGATTGTCCGCGAGGTAGGCAAGGATTCCCTCACCT
GCGAGGTGGAGAACGGCGGCTCTCTGGGTTCCCGCAAGGGTGTGAACCTG
CCAGGCGTGCCCGTCGATCTGCCTGCCGTCTCCGAGAAGGATAAGAGCGA
TCTGCTGTTCGGTGTGGAGCAGGAAGTGGACATGATCTTTGCTTCGTTCA
TCCGCAACGCCGCTGCTTTGACCGAGATCCGTAAGGTTCTTGGCGAGAAG
GGCCAGAACATCAAGATCATTTCCAAGATCGAGAACCAGCAGGGCATGCA
CAACCTGGACGAGATCATCGAGGCCGGTGATGGCATTATGGTGGCCGTGG
AGATCTGGGTATTGAGATTCCCGCCGAGAAGTGTT

FMO10009.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:00
Subject Length Description Subject Range Query Range Score Percent Strand
PyK-RA 2109 CG7070-RA 243..1166 9..931 4580 99.8 Plus
PyK-RB 1958 CG7070-RB 132..1015 49..931 4380 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:56
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 22370776..22371659 49..931 4355 99.8 Plus
3R 32079331 3R 22369524..22369565 9..50 210 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:10:59 has no hits.

FMO10009.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:26 Download gff for FMO10009.5prime
Subject Subject Range Query Range Percent Splice Strand
PyK-RA 310..1245 1..935 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:10 Download gff for FMO10009.5prime
Subject Subject Range Query Range Percent Splice Strand
PyK-RA 236..1171 1..935 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:17 Download gff for FMO10009.5prime
Subject Subject Range Query Range Percent Splice Strand
PyK-RA 236..1171 1..935 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:17 Download gff for FMO10009.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 22370778..22371664 51..935 99   Plus
3R 22369517..22369565 1..50 92 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:10 Download gff for FMO10009.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 18196500..18197386 51..935 99   Plus
arm_3R 18195239..18195287 1..50 92 -> Plus