Clone FMO10010 Report

Search the DGRC for FMO10010

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:10
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG14960-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10010.5prime Sequence

1015 bp (1015 high quality bases) assembled on 2010-10-30

> FMO10010.5prime
CAGTCGACATGTTTCTCACAAAGAGTTCAAGTGCGCGGCACTCGTTGCTG
CTGCTTCTGTTGGCCTTTTGCTGCCTGAGCAATGCCTTTGCAGCCAAGAT
AACGAAGAAGGTCGAAAAAACGTCGGAAAAGCCAGAGGTGGAGGCTGCTG
CATCGCCAATCGAGGAGGAAAATGACGATGAAGATGCTGGCGAGGATGGT
GATGACGACGACGACGACGAGGAGGAGGAGACGGGGGAACCTGCGGTGGA
TGCGGCTGACAAAGAAGCTGCAGTAGGGGCATCGAGTAACAAGAACCCCA
ATGCAGTGCAGGCAGCCACGGATCCCACAGATCTCAGTGTCTGGGGCATG
GTTCGCACTCTGTGGGGCTGGCTTCGTAGCGATCTGAGTGAAAGCCTATT
CGGCGATGACGACGACGGGAAGCCCGCGTCCGGCAGCTCAGCTGTGGAGG
GTCGTACCTTTGGCAAAATCCGCCGTCTTCAAATGGCTTTGATACCCATT
ATCTTTAAGTTTGGCGTCCTTTCGGCTATGGTTGCCTTTCTGGTCGCCAT
TGGTATGAAGTCTCTGTTCCTGCTCAAGGTCTTAGTGGTTATGAATGCCA
TTGCCATTCTGGGAAAGTTCATTACCCTGAAGTCCAGTCTATTTGGACAG
TATGAGAACACGGCGCCGTCCTTCAATTACCCGGGCTGGAATCCTCATGC
CAAGGAGTCGTGGGGCACCACTGGATTGAGTGGTCATGGCGCTGGTCATC
CACCCAGCAAGGAGATTCACCTGCACATCCACGGAAATGCCCAGACCCAG
GCTCAGCTCGCCGGTCAGGGCTATCAGTATGAATCGCAGTCGGGTGGATG
GGCCAGTCGATCGGATCCCTATGGAGCCTATGCACCACGGGCCAATTCAC
CGATAGCCAGCCCGTGGGAGCAGTGACCGGAGAGGTGCCCAACATACGGA
TCCCATGTCCCTGCTGCCCACGAATTATCGGCGGAGACAACTCATCGTGC
AGCTTTCTAGACCAT

FMO10010.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG14960-RA 1444 CG14960-RA 242..1231 9..996 4840 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:01
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3275491..3276042 447..996 2600 98.9 Plus
3L 28110227 3L 3274044..3274480 11..447 2185 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:03 has no hits.

FMO10010.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:27 Download gff for FMO10010.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14960-RA 235..1237 4..1003 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:11 Download gff for FMO10010.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14960-RA 237..1239 4..1003 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:19 Download gff for FMO10010.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14960-RA 237..1239 4..1003 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:19 Download gff for FMO10010.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 3275492..3276050 448..1003 98   Plus
3L 3274042..3274480 8..447 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:11 Download gff for FMO10010.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3275492..3276050 448..1003 98   Plus
arm_3L 3274042..3274480 8..447 99 -> Plus