Clone FMO10012 Report

Search the DGRC for FMO10012

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:12
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG1665-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10012.5prime Sequence

765 bp (760 high quality bases) assembled on 2010-10-30

> FMO10012.5prime
CAGTCGACATGGCAACCGGCGGAAATAACTCGATCTTTGACCTCAGTCCC
AAGACCCTGGCGGCCGTGGGCGTGGGCCTGGTGGCGGTGGGCGGGGCTAG
CTTCCTACTGTACCGCCATCTGACCCGCGATGTGGTTCCCCAAAAGTGGC
GACGCGTGGGCACCGTGGAGAGGATACACTTTTTTCCGGTCAAGTCCTGT
GCCCCTATGGACATCTCGAAGCCCGGAGTGGAGTACGACTGCGATGTACT
GAGCATGTCCTTTGAGGGAATAAGGGATCGCACCTTGATGGTGGTCAATG
AAAAGAACGAAATGATCACGGCTCGGGTGTATCCGCTTATGACCCAGATC
AAGTCGAAGAAGGTGTCGCCCAGCAAGCTTGTGTTCAGCGCCCAGGACAT
GCCAGACCTGGAGCTGGACTTCGAGAAGCTGGACGGTCCTGGCAAGGATG
TGAAAACTTCCGTTTGGGGCGTTTCCATAGACGTGATGCCCTGCGGAGAT
CGGATCAACACGTGGTTCTCCCAGGCCATCCTGATGAAGGAGAGCGGCCT
CAAGCTAGTTCACTATCCCTATCCGAAACCAGTGAGATGCACCAATCCCC
GCCTAAAGTCCATGCCATTCATTAGACAGGAGGACTCGGGCACTTTTAAC
GATGCCACCAGCTTTATGCTGATGAACCTTTCGTCGGTCGCCGATCTTAA
TACTCGGTTAAAGAATCCGGTGGATGCACTGCAGTTCCGAGGTAACTTCG
AACTGAAATTGGGAT

FMO10012.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:07
Subject Length Description Subject Range Query Range Score Percent Strand
CG1665-RA 1189 CG1665-RA 53..806 9..762 3725 99.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:05
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 9839889..9840516 12..639 3095 99.5 Plus
2R 25286936 2R 9840583..9840707 638..762 610 99.2 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:06 has no hits.

FMO10012.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:27 Download gff for FMO10012.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1665-RA 30..793 1..765 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:14 Download gff for FMO10012.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1665-RA 45..808 1..765 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:21 Download gff for FMO10012.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1665-RA 45..808 1..765 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:21 Download gff for FMO10012.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 9840584..9840709 639..765 98   Plus
2R 9839885..9840515 4..638 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:14 Download gff for FMO10012.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 5728089..5728214 639..765 98   Plus
arm_2R 5727390..5728020 4..638 98 -> Plus